TGIF2 Rabbit Polyclonal Antibody

TGIF2 Rabbit Polyclonal Antibody

 

TGIF2 Antibody

1-CSB-PA884421LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal TGIF2 Antibody (C-term)

APR04017G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TGIF2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-TGIF2 Antibody

APG00329G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TGIF2 . This antibody is tested and proven to work in the following applications:

Anti-TGIF2 antibody

PAab08647 100 ug
EUR 386

Anti-TGIF2 antibody

STJ70768 100 µg
EUR 359

Anti-TGIF2 antibody

STJ190900 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TGIF2

Polyclonal Tgif2 Antibody - N-terminal region

APR00626G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tgif2 - N-terminal region. This antibody is tested and proven to work in the following applications:

TGIF2 siRNA

20-abx936635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGIF2 siRNA

20-abx936636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGIF2 Antibody, HRP conjugated

1-CSB-PA884421LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TGIF2 Antibody, FITC conjugated

1-CSB-PA884421LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TGIF2 Antibody, Biotin conjugated

1-CSB-PA884421LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Homeobox protein TGIF2, Tgif2 ELISA KIT

ELI-39996m 96 Tests
EUR 865

Human Homeobox protein TGIF2, TGIF2 ELISA KIT

ELI-41901h 96 Tests
EUR 824

TGIF2 cloning plasmid

CSB-CL884421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgtcggacagtgatctaggtgaggacgaaggcctcctctccctggcgggcaaaaggaagcgcagggggaacctgcccaaggagtcggtgaagatcctccgggactggctgtacttgcaccgctacaacgcctacccctcagagcaggagaagctgagcctttctggacagaccaa
  • Show more
Description: A cloning plasmid for the TGIF2 gene.

TGIF2 ELISA KIT|Human

EF003569 96 Tests
EUR 689

Mouse TGIF2 shRNA Plasmid

20-abx981658
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TGIF2 shRNA Plasmid

20-abx961792
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TGIF2 Recombinant Protein (Human)

RP031408 100 ug Ask for price

TGIF2 Recombinant Protein (Mouse)

RP178469 100 ug Ask for price

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx028320-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx028320-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx238647-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

20-abx333861
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx431744-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Monoclonal TGIF2 Antibody (monoclonal) (M01), Clone: 4C10

AMM04194G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TGIF2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4C10. This antibody is applicable in WB, E

Monoclonal TGIF2 Antibody (monoclonal) (M06), Clone: 6A8

AMM04195G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TGIF2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 6A8. This antibody is applicable in WB and IF, E

TGIF2 ORF Vector (Human) (pORF)

ORF010470 1.0 ug DNA
EUR 95

Tgif2 ORF Vector (Mouse) (pORF)

ORF059491 1.0 ug DNA
EUR 506

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody (HRP)

20-abx336057
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody (FITC)

20-abx336058
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody (Biotin)

20-abx336059
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tgif2 sgRNA CRISPR Lentivector set (Mouse)

K4843001 3 x 1.0 ug
EUR 339

TGIF2 sgRNA CRISPR Lentivector set (Human)

K2365401 3 x 1.0 ug
EUR 339

Tgif2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4843002 1.0 ug DNA
EUR 154

Tgif2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4843003 1.0 ug DNA
EUR 154

Tgif2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4843004 1.0 ug DNA
EUR 154

TGIF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2365402 1.0 ug DNA
EUR 154

TGIF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2365403 1.0 ug DNA
EUR 154

TGIF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2365404 1.0 ug DNA
EUR 154

TGIF2 Protein Vector (Human) (pPB-C-His)

PV041877 500 ng
EUR 329

TGIF2 Protein Vector (Human) (pPB-N-His)

PV041878 500 ng
EUR 329

TGIF2 Protein Vector (Human) (pPM-C-HA)

PV041879 500 ng
EUR 329

TGIF2 Protein Vector (Human) (pPM-C-His)

PV041880 500 ng
EUR 329

TGIF2 Protein Vector (Mouse) (pPB-C-His)

PV237962 500 ng
EUR 603

TGIF2 Protein Vector (Mouse) (pPB-N-His)

PV237963 500 ng
EUR 603

TGIF2 Protein Vector (Mouse) (pPM-C-HA)

PV237964 500 ng
EUR 603

TGIF2 Protein Vector (Mouse) (pPM-C-His)

PV237965 500 ng
EUR 603

Tgif2 3'UTR Luciferase Stable Cell Line

TU221832 1.0 ml Ask for price

TGIF2 3'UTR GFP Stable Cell Line

TU075493 1.0 ml
EUR 1521

Tgif2 3'UTR GFP Stable Cell Line

TU271832 1.0 ml Ask for price

TGIF2 3'UTR Luciferase Stable Cell Line

TU025493 1.0 ml
EUR 1521

Human TGFB Induced Factor Homeobox 2 (TGIF2) ELISA Kit

abx383728-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TGIF2 Rabbit Polyclonal Antibody