TGIF2 Rabbit Polyclonal Antibody

TGIF2 Rabbit Polyclonal Antibody

 

TGIF2 Antibody

1-CSB-PA884421LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal Goat Anti-TGIF2 Antibody

APG00329G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TGIF2 . This antibody is tested and proven to work in the following applications:

Polyclonal TGIF2 Antibody (C-term)

APR04017G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TGIF2 (C-term). This antibody is tested and proven to work in the following applications:

Anti-TGIF2 antibody

PAab08647 100 ug
EUR 386

Anti-TGIF2 antibody

STJ70768 100 µg
EUR 359

Anti-TGIF2 antibody

STJ190900 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TGIF2

Polyclonal Tgif2 Antibody - N-terminal region

APR00626G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Tgif2 - N-terminal region. This antibody is tested and proven to work in the following applications:

TGIF2 siRNA

20-abx936635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGIF2 siRNA

20-abx936636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGIF2 Antibody, HRP conjugated

1-CSB-PA884421LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TGIF2 Antibody, FITC conjugated

1-CSB-PA884421LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TGIF2 Antibody, Biotin conjugated

1-CSB-PA884421LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGIF2. Recognizes TGIF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Homeobox protein TGIF2, Tgif2 ELISA KIT

ELI-39996m 96 Tests
EUR 865

Human Homeobox protein TGIF2, TGIF2 ELISA KIT

ELI-41901h 96 Tests
EUR 824

TGIF2 cloning plasmid

CSB-CL884421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgtcggacagtgatctaggtgaggacgaaggcctcctctccctggcgggcaaaaggaagcgcagggggaacctgcccaaggagtcggtgaagatcctccgggactggctgtacttgcaccgctacaacgcctacccctcagagcaggagaagctgagcctttctggacagaccaa
  • Show more
Description: A cloning plasmid for the TGIF2 gene.

TGIF2 ELISA KIT|Human

EF003569 96 Tests
EUR 689

Mouse TGIF2 shRNA Plasmid

20-abx981658
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TGIF2 shRNA Plasmid

20-abx961792
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TGIF2 Recombinant Protein (Human)

RP031408 100 ug Ask for price

TGIF2 Recombinant Protein (Mouse)

RP178469 100 ug Ask for price

Monoclonal TGIF2 Antibody (monoclonal) (M01), Clone: 4C10

AMM04194G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TGIF2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4C10. This antibody is applicable in WB, E

Monoclonal TGIF2 Antibody (monoclonal) (M06), Clone: 6A8

AMM04195G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TGIF2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 6A8. This antibody is applicable in WB and IF, E

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx028320-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx028320-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

20-abx333861
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx431744-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody

abx238647-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tgif2 ORF Vector (Mouse) (pORF)

ORF059491 1.0 ug DNA
EUR 506

TGIF2 ORF Vector (Human) (pORF)

ORF010470 1.0 ug DNA
EUR 95

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody (HRP)

20-abx336057
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody (FITC)

20-abx336058
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGFB Induced Factor Homeobox 2 (TGIF2) Antibody (Biotin)

20-abx336059
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TGIF2 sgRNA CRISPR Lentivector set (Human)

K2365401 3 x 1.0 ug
EUR 339

Tgif2 sgRNA CRISPR Lentivector set (Mouse)

K4843001 3 x 1.0 ug
EUR 339

TGIF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2365402 1.0 ug DNA
EUR 154

TGIF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2365403 1.0 ug DNA
EUR 154

TGIF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2365404 1.0 ug DNA
EUR 154

Tgif2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4843002 1.0 ug DNA
EUR 154

Tgif2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4843003 1.0 ug DNA
EUR 154

Tgif2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4843004 1.0 ug DNA
EUR 154

TGIF2 Protein Vector (Human) (pPB-C-His)

PV041877 500 ng
EUR 329

TGIF2 Protein Vector (Human) (pPB-N-His)

PV041878 500 ng
EUR 329

TGIF2 Protein Vector (Human) (pPM-C-HA)

PV041879 500 ng
EUR 329

TGIF2 Protein Vector (Human) (pPM-C-His)

PV041880 500 ng
EUR 329

TGIF2 Protein Vector (Mouse) (pPB-C-His)

PV237962 500 ng
EUR 603

TGIF2 Protein Vector (Mouse) (pPB-N-His)

PV237963 500 ng
EUR 603

TGIF2 Protein Vector (Mouse) (pPM-C-HA)

PV237964 500 ng
EUR 603

TGIF2 Protein Vector (Mouse) (pPM-C-His)

PV237965 500 ng
EUR 603

TGIF2 3'UTR GFP Stable Cell Line

TU075493 1.0 ml
EUR 1521

TGIF2 3'UTR Luciferase Stable Cell Line

TU025493 1.0 ml
EUR 1521

Tgif2 3'UTR Luciferase Stable Cell Line

TU221832 1.0 ml Ask for price

Tgif2 3'UTR GFP Stable Cell Line

TU271832 1.0 ml Ask for price

Human TGFB Induced Factor Homeobox 2 (TGIF2) ELISA Kit

abx383728-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

TGIF2 Rabbit Polyclonal Antibody