SIX4 Rabbit Polyclonal Antibody

SIX4 Rabbit Polyclonal Antibody

 

SIX4 Polyclonal Antibody
ES9741-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SIX4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SIX4 Rabbit pAb
A14406-100ul 100 ul
EUR 308

SIX4 Rabbit pAb
A14406-200ul 200 ul
EUR 459

SIX4 Rabbit pAb
A14406-20ul 20 ul
EUR 183

SIX4 Rabbit pAb
A14406-50ul 50 ul
EUR 223

SIX4 antibody
70R-20287 50 ul
EUR 435
Description: Rabbit polyclonal SIX4 antibody

SIX4 Antibody
46025-100ul 100ul
EUR 252

SIX4 Antibody
46025-50ul 50ul
EUR 187

SIX4 Antibody
DF9592 200ul
EUR 304
Description: SIX4 Antibody detects endogenous levels of total SIX4.

SIX4 Antibody
1-CSB-PA021351GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SIX4. Recognizes SIX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SIX4 Antibody
ABD9592 100 ug
EUR 438

SIX4 Conjugated Antibody
C46025 100ul
EUR 397

anti- SIX4 antibody
FNab07888 100µg
EUR 548.75
  • Immunogen: SIX homeobox 4
  • Uniprot ID: Q9UIU6
  • Gene ID: 51804
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against SIX4

Anti-SIX4 antibody
PAab07888 100 ug
EUR 386

Anti-SIX4 antibody
STJ118043 100 µl
EUR 277
Description: This gene encodes a member of the homeobox family, subfamily SIX. The drosophila homolog is a nuclear homeoprotein required for eye development. Studies in mouse show that this gene product functions as a transcription factor, and may have a role in the differentiation or maturation of neuronal cells.

Anti-SIX4 antibody
STJ190899 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SIX4

SIX4 siRNA
20-abx933425
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SIX4 siRNA
20-abx933426
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Homeobox protein SIX4, SIX4 ELISA KIT
ELI-29826h 96 Tests
EUR 824

Mouse Homeobox protein SIX4, Six4 ELISA KIT
ELI-39402m 96 Tests
EUR 865

SIX4 Blocking Peptide
DF9592-BP 1mg
EUR 195

SIX4 cloning plasmid
CSB-CL883445HU-10ug 10ug
EUR 749
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: ATGGAAAGCGCCTCGGAAGGGCAGGAGGCGCACCGAGAAGTGGCGGGGGGCGCGGCGGTAGGGCTGAGCCCCCCGGCTCCAGCCCCTTTTCCCCTGGAGCCGGGGGACGCCGCGACCGCTGCCGCCAGGGTGAGCGGAGAGGAAGGGGCAGTGGCGGCGGCGGCGGCCGGAGCGG
  • Show more
Description: A cloning plasmid for the SIX4 gene.

SIX Homeobox 4 (SIX4) Antibody
20-abx218597
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Six Homeobox 4 (SIX4) Antibody
20-abx115581
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

SIX Homeobox 4 (SIX4) Antibody
abx237888-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SIX4 ELISA KIT|Human
EF002946 96 Tests
EUR 689

Mouse SIX4 shRNA Plasmid
20-abx972714
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SIX4 shRNA Plasmid
20-abx959949
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SIX4 Recombinant Protein (Human)
RP043324 100 ug Ask for price

SIX4 Recombinant Protein (Rat)
RP228803 100 ug Ask for price

SIX4 Recombinant Protein (Mouse)
RP172025 100 ug Ask for price

Recombinant human Homeobox protein SIX4
P2824 100ug Ask for price
  • Uniprot ID: Q9UIU6
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Homeobox protein SIX4

Six4 ORF Vector (Rat) (pORF)
ORF076269 1.0 ug DNA
EUR 506

SIX4 ORF Vector (Human) (pORF)
ORF014442 1.0 ug DNA
EUR 354

Six4 ORF Vector (Mouse) (pORF)
ORF057343 1.0 ug DNA
EUR 506

Six4 sgRNA CRISPR Lentivector set (Rat)
K6125401 3 x 1.0 ug
EUR 339

Six4 sgRNA CRISPR Lentivector set (Mouse)
K3376601 3 x 1.0 ug
EUR 339

SIX4 sgRNA CRISPR Lentivector set (Human)
K2152901 3 x 1.0 ug
EUR 339

Human SIX Homeobox 4 (SIX4) ELISA Kit
abx383212-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Six4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6125402 1.0 ug DNA
EUR 154

Six4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6125403 1.0 ug DNA
EUR 154

Six4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6125404 1.0 ug DNA
EUR 154

Six4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3376602 1.0 ug DNA
EUR 154

Six4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3376603 1.0 ug DNA
EUR 154

Six4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3376604 1.0 ug DNA
EUR 154

SIX4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2152902 1.0 ug DNA
EUR 154

SIX4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2152903 1.0 ug DNA
EUR 154

SIX4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2152904 1.0 ug DNA
EUR 154

SIX4 Protein Vector (Rat) (pPB-C-His)
PV305074 500 ng
EUR 1191

SIX4 Protein Vector (Rat) (pPB-N-His)
PV305075 500 ng
EUR 1191

SIX4 Protein Vector (Rat) (pPM-C-HA)
PV305076 500 ng
EUR 1191

SIX4 Protein Vector (Rat) (pPM-C-His)
PV305077 500 ng
EUR 1191

SIX4 Protein Vector (Human) (pPB-C-His)
PV057765 500 ng
EUR 481

SIX4 Protein Vector (Human) (pPB-N-His)
PV057766 500 ng
EUR 481

SIX4 Protein Vector (Human) (pPM-C-HA)
PV057767 500 ng
EUR 481

SIX4 Protein Vector (Human) (pPM-C-His)
PV057768 500 ng
EUR 481

SIX4 Protein Vector (Mouse) (pPB-C-His)
PV229370 500 ng
EUR 1065

SIX4 Protein Vector (Mouse) (pPB-N-His)
PV229371 500 ng
EUR 1065

SIX4 Protein Vector (Mouse) (pPM-C-HA)
PV229372 500 ng
EUR 1065

SIX4 Protein Vector (Mouse) (pPM-C-His)
PV229373 500 ng
EUR 1065

Six4 3'UTR Luciferase Stable Cell Line
TU118851 1.0 ml Ask for price

Six4 3'UTR GFP Stable Cell Line
TU168851 1.0 ml Ask for price

Six4 3'UTR Luciferase Stable Cell Line
TU220391 1.0 ml Ask for price

Six4 3'UTR GFP Stable Cell Line
TU270391 1.0 ml Ask for price

SIX4 3'UTR GFP Stable Cell Line
TU073235 1.0 ml
EUR 2333

SIX4 3'UTR Luciferase Stable Cell Line
TU023235 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

SIX4 Rabbit Polyclonal Antibody