Nerve Growth Factor Research

Nerve Growth Factor Life Science reagents:

NGF Conjugated Antibody

C32048 100ul
EUR 397

NGF cloning plasmid

CSB-CL015779HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgtccatgttgttctacactctgatcacagcttttctgatcggcatacaggcggaaccacactcagagagcaatgtccctgcaggacacaccatcccccaagtccactggactaaacttcagcattcccttgacactgcccttcgcagagcccgcagcgccccggcagcggcgat
  • Show more
Description: A cloning plasmid for the NGF gene.

p75/NGF Receptor

GT15057 100 ug
EUR 526

anti- NGF antibody

FNab10116 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: NGF
  • Uniprot ID: P01138
  • Gene ID: 4803
  • Research Area: Neuroscience, Immunology, Stem cells, Cancer
Description: Antibody raised against NGF

NGF Polyclonal Antibody

ES2958-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NGF Polyclonal Antibody

ES2958-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NGF Polyclonal Antibody

ES4295-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NGF Polyclonal Antibody

ES4295-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NGF Polyclonal Antibody

ABP53296-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
Description: A polyclonal antibody for detection of NGF from Human. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

NGF Polyclonal Antibody

ABP53296-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
Description: A polyclonal antibody for detection of NGF from Human. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

NGF Polyclonal Antibody

ABP53296-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
Description: A polyclonal antibody for detection of NGF from Human. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

NGF beta Antibody

ABF5172 100 ug
EUR 438

NGF Polyclonal Antibody

ABP51959-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
Description: A polyclonal antibody for detection of NGF from Human, Mouse, Rat. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

NGF Polyclonal Antibody

ABP51959-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
Description: A polyclonal antibody for detection of NGF from Human, Mouse, Rat. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

NGF Polyclonal Antibody

ABP51959-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
Description: A polyclonal antibody for detection of NGF from Human, Mouse, Rat. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

NGF Rabbit pAb

A0258-100ul 100 ul
EUR 308

NGF Rabbit pAb

A0258-200ul 200 ul
EUR 459

NGF Rabbit pAb

A0258-20ul 20 ul
EUR 183

NGF Rabbit pAb

A0258-50ul 50 ul
EUR 223

Ngf Polyclonal Antibody

A52042 100 µg
EUR 570.55
Description: reagents widely cited

beta NGF antibody

70R-NR007 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal beta NGF antibody

NGF Rabbit pAb

A13922-100ul 100 ul
EUR 308

NGF Rabbit pAb

A13922-200ul 200 ul
EUR 459

NGF Rabbit pAb

A13922-20ul 20 ul
EUR 183

NGF Rabbit pAb

A13922-50ul 50 ul
EUR 223

NGF Rabbit pAb

A14216-100ul 100 ul
EUR 308

NGF Rabbit pAb

A14216-200ul 200 ul
EUR 459

NGF Rabbit pAb

A14216-20ul 20 ul
EUR 183

NGF Rabbit pAb

A14216-50ul 50 ul
EUR 223

NGF Polyclonal Antibody

A64862 100 µg
EUR 570.55
Description: The best epigenetics products

NGF Polyclonal Antibody

41931-100ul 100ul
EUR 252

NGF Polyclonal Antibody

41931-50ul 50ul
EUR 187

NGF Polyclonal Antibody

41239-100ul 100ul
EUR 252

NGF Polyclonal Antibody

41239-50ul 50ul
EUR 187

NGF beta Antibody

48321-100ul 100ul
EUR 333

NGF beta Antibody

48321-50ul 50ul
EUR 239

beta NGF antibody

10R-N127A 500 ug
EUR 273
Description: Mouse monoclonal beta NGF antibody

NGF beta protein

30R-2354 5 ug
EUR 224
Description: Purified recombinant Human NGF beta protein

NGF beta protein

30R-2553 20 ug
EUR 353
Description: Purified recombinant Human NGF beta protein

NGF beta protein

30R-2554 20 ug
EUR 336
Description: Purified recombinant Human NGF beta protein

beta NGF protein

30R-AB039 20 ug
EUR 273
Description: Purified recombinant Human beta NGF protein

beta NGF protein

30R-AN001 20 ug
EUR 273
Description: Purified recombinant Human beta NGF protein

NGF beta antibody

70R-13739 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal NGF beta antibody

NGF Blocking Peptide

DF6061-BP 1mg
EUR 195

NGF-b, Mouse

PR27003 5 ug
EUR 191

p75/NGF Receptor

MO15047 100 ug
EUR 383

Anti-NGF Antibody

PA1056 100ug/vial
EUR 294

Anti-NGF Antibody

RP1025 100ug/vial
EUR 294

pcDNA3.1-NGF Plasmid

PVTB00747-2a 2 ug
EUR 356

Anti-NGF antibody

STJ94479 200 µl
EUR 197
Description: Rabbit polyclonal to NGF.

Anti-NGF antibody

STJ97260 200 µl
EUR 197
Description: NGF is a protein encoded by the NGF gene which is approximately 26,9 kDa. NGF is secreted into the extracellular space. It is involved in apoptotic pathways, p75 NTR receptor-mediated signalling, RET signalling and the GPCR pathway. It is a secreted protein which homodimerizes and is incorporated into a larger complex. It has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. NGF is expressed in the nervous system, blood, eye, adrenal gland and muscle. Mutations in the NGF gene may result in corneal ulcers. STJ97260 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of NGF protein.

Anti-NGF antibody

STJ28269 100 µl
EUR 277
Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

Anti-NGF antibody

STJ119971 100 µl
EUR 413
Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

Anti-NGF antibody

STJ13100190 100 µg
EUR 427

Anti-NGF antibody

STJ13100200 100 µl
EUR 427

Anti-NGF antibody

STJ13100203 100 µl
EUR 427

Anti-NGF antibody

STJ116148 100 µl
EUR 277
Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

Anti-NGF antibody

STJ115857 100 µl
EUR 277
Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

Monkey primate NGF/NGF Beta PicoKine™ ELISA Kit

EK0469-PR 96 wells
EUR 425
Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of monkey primate NGF/NGF beta. 96wells/kit, with removable strips.

beta-NGF/β-Nerve Growth Factor/β-NGF(131-239)

E21-793 10ug
EUR 343

Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-100ug

QP5351-100ug 100ug
EUR 490

Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-1mg

QP5351-1mg 1mg
EUR 2856

Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-20ug

QP5351-20ug 20ug
EUR 237

Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-500ug

QP5351-500ug 500ug
EUR 1778

Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-5ug

QP5351-5ug 5ug
EUR 136

Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-100ug

QP5412-100ug 100ug
EUR 490

Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-1mg

QP5412-1mg 1mg
EUR 2856

Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-20ug

QP5412-20ug 20ug
EUR 237

Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-500ug

QP5412-500ug 500ug
EUR 1778

Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-5ug

QP5412-5ug 5ug
EUR 136

NGF beta Blocking Peptide

AF5172-BP 1mg
EUR 195

NGF beta Conjugated Antibody

C48321 100ul
EUR 397

Rat NGF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E0105h 96 Tests
EUR 824


EHN0021 96Tests
EUR 521


EGTN0021 96Tests
EUR 521

Bovine NGF ELISA Kit

EBN0021 96Tests
EUR 521

Chicken NGF ELISA Kit

ECKN0021 96Tests
EUR 521

Canine NGF ELISA Kit

ECN0021 96Tests
EUR 521

Anserini NGF ELISA Kit

EAN0021 96Tests
EUR 521

Porcine NGF ELISA Kit

EPN0021 96Tests
EUR 521


ERN0021 96Tests
EUR 521

Rabbit NGF ELISA Kit

ERTN0021 96Tests
EUR 521


ESN0021 96Tests
EUR 521

Monkey NGF ELISA Kit

EMKN0021 96Tests
EUR 521


EMN0021 96Tests
EUR 521

Mouse NGF beta Protein

abx060200-100ug 100 ug
EUR 843
  • Shipped within 5-10 working days.

Mouse NGF beta Protein

abx060257-100ug 100 ug
EUR 843
  • Shipped within 5-10 working days.

Human NGF-b Protein

abx060814-20ug 20 ug
EUR 523
  • Shipped within 5-10 working days.

NGF beta Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human NGF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NGF recombinant monoclonal antibody

A5483 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NGF for WB, IHC, IF,ELISA

NGF-beta, human recombinant

EUR 4019

NGF-beta, human recombinant

EUR 294

NGF-beta, human recombinant

EUR 697

NGF-beta, human recombinant

EUR 3693

NGF-beta, human recombinant

EUR 251

NGF-beta, murine recombinant

EUR 936

NGF-beta, murine recombinant

EUR 5025

NGF-beta, murine recombinant

EUR 332

NGF-beta, murine recombinant

EUR 169

p75 NGF Receptor Antibody

48609-100ul 100ul
EUR 333

p75 NGF Receptor Antibody

48609-50ul 50ul
EUR 239

Mouse NGF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NGF Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NGF. Recognizes NGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NGF Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NGF. Recognizes NGF from Pig. This antibody is HRP conjugated. Tested in the following application: ELISA

NGF Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NGF. Recognizes NGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NGF Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NGF. Recognizes NGF from Pig. This antibody is FITC conjugated. Tested in the following application: ELISA

NGF Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NGF. Recognizes NGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NGF Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NGF. Recognizes NGF from Pig. This antibody is Biotin conjugated. Tested in the following application: ELISA

Ngf Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ngf. Recognizes Ngf from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Ngf Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ngf. Recognizes Ngf from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Ngf Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ngf. Recognizes Ngf from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

NGF-b, NSO Derived

PR15083 100 ug
EUR 422

NGF-b, Human, CHO

PR27002 5 ug
EUR 191


PVT16688 2 ug
EUR 325

Anti-native NGF antibody

STJ13100189 150 µl
EUR 427

anti-p75 NGF Receptor

YF-PA13443 100 ug
EUR 403
Description: Rabbit polyclonal to p75 NGF Receptor

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-100ug

QP9305-ye-100ug 100ug
EUR 571

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-10ug

QP9305-ye-10ug 10ug
EUR 272

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-1mg

QP9305-ye-1mg 1mg
EUR 2303

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-200ug

QP9305-ye-200ug 200ug
EUR 898

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-500ug

QP9305-ye-500ug 500ug
EUR 1505

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-50ug

QP9305-ye-50ug 50ug
EUR 354

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-100ug

QP8881-ec-100ug 100ug
EUR 571

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-10ug

QP8881-ec-10ug 10ug
EUR 272

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-1mg

QP8881-ec-1mg 1mg
EUR 2303

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-200ug

QP8881-ec-200ug 200ug
EUR 898

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-500ug

QP8881-ec-500ug 500ug
EUR 1514

Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-50ug

QP8881-ec-50ug 50ug
EUR 362

Human NGF/NGF beta EZ-Set™ ELISA Kit (DIY Antibody Pairs)

EZ0469 5 plates/kit
EUR 309
Description: For the development of sandwich ELISA kit to measure human NGF/NGF beta in cell culture supernates and serum.

Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-100ug

QP7637-ec-100ug 100ug
EUR 707

Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-10ug

QP7637-ec-10ug 10ug
EUR 326

Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-1mg

QP7637-ec-1mg 1mg
EUR 2303

Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-200ug

QP7637-ec-200ug 200ug
EUR 1115

Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-500ug

QP7637-ec-500ug 500ug
EUR 1514

Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-50ug

QP7637-ec-50ug 50ug
EUR 435

Active Nerve Growth Factor (NGF)

  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22894
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: 10.1
Description: Recombinant Human Nerve Growth Factor expressed in: E.coli

Active Nerve Growth Factor (NGF)

  • EUR 673.44
  • EUR 283.00
  • EUR 2250.40
  • EUR 816.80
  • EUR 1533.60
  • EUR 514.00
  • EUR 5476.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25427
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 9.4
Description: Recombinant Rat Nerve Growth Factor expressed in: E.coli

p75 NGF Receptor Conjugated Antibody

C48609 100ul
EUR 397


ADC-W-1664 1mg Ask for price
Description: This ADC product is comprised of an anti-NGF monoclonal antibody conjugated via a SMCC linker to DM1


ADC-W-1665 1mg Ask for price
Description: This ADC product is comprised of an anti-NGF monoclonal antibody conjugated via a SPDB linker to DM4


ADC-W-1666 1mg Ask for price
Description: This ADC product is comprised of an anti-NGF monoclonal antibody conjugated via a MC linker to MMAF

Guinea Pig NGF ELISA Kit

EGN0021 96Tests
EUR 521


ERB0161 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 18.75pg/ml

Eukaryotic Nerve Growth Factor (NGF)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19093
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 9.9
Description: Recombinant Human Nerve Growth Factor expressed in: 293F Cell

Nerve Growth Factor (NGF) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

pro-NGF beta Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nerve Growth Factor (NGF) Antibody

abx033672-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

abx033672-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 300.00
  • EUR 718.00
  • EUR 384.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 954.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 1024.00
  • EUR 509.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1066.00
  • EUR 523.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 1372.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nerve Growth Factor (NGF) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nerve Growth Factor (NGF) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ngf Polyclonal Antibody, HRP Conjugated

A52043 100 µg
EUR 570.55
Description: Ask the seller for details

Ngf Polyclonal Antibody, FITC Conjugated

A52044 100 µg
EUR 570.55
Description: The best epigenetics products

Ngf Polyclonal Antibody, Biotin Conjugated

A52045 100 µg
EUR 570.55
Description: kits suitable for this type of research

[KO Validated] NGF Rabbit pAb

A17998-100ul 100 ul
EUR 410

[KO Validated] NGF Rabbit pAb

A17998-200ul 200 ul
EUR 571

[KO Validated] NGF Rabbit pAb

A17998-20ul 20 ul
EUR 221

[KO Validated] NGF Rabbit pAb

A17998-50ul 50 ul
EUR 287

NGF Polyclonal Antibody, HRP Conjugated

A64863 100 µg
EUR 570.55
Description: kits suitable for this type of research

NGF Polyclonal Antibody, FITC Conjugated

A64864 100 µg
EUR 570.55
Description: fast delivery possible

NGF Polyclonal Antibody, Biotin Conjugated

A64865 100 µg
EUR 570.55
Description: reagents widely cited

Beta-NGF (human) ELISA Kit

K4787-100 100 assays
EUR 834
  • Kit components:
  • Beta-NGF Ab coated plate (Item A), 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Human Beta-NGF Standard (Item C)
  • Assay Diluent (5x) (Item E)
  • Biotinylated anti-human Beta-NGF Ab (Item F)
  • HRP-Streptavidin Concentrate (8
  • Show more
Description: Sensitive, Colorimetric Assay

NGF-b, NSO Derived, CF

PR15084CF 100 ug
EUR 422

Recombinant Human Beta -NGF Protein

PROTP01138-4 100ug
EUR 317
Description: β-NGF is a neurotrophic factor structurally related to BDNF, NT-3 and NT-4. These proteins belong to the cysteine-knot family of growth factors that assume stable dimeric structures. β-NGF is a potent neurotrophic factor that signals through its receptor β-NGFR, and plays a crucial role in the development and preservation of the sensory and sympathetic nervous systems. β-NGF also acts as a growth and differentiation factor for B lymphocytes and enhances B-cell survival. The functional form of human β-NGF is a noncovalently disulfide-linked homodimer, of two 13.5 kDa polypeptide monomers (240 total amino acid residues). The three disulfide bonds are required for biological activity.

Recombinant Murine Beta -NGF Protein

PROTP01139-2 20ug
EUR 317
Description: β-NGF is a neurotrophic factor structurally related to BDNF, NT-3 and NT-4. These proteins belong to the cysteine-knot family of growth factors that assume stable dimeric structures. β-NGF is a potent neurotrophic factor that signals through its receptor β-NGFR, and plays a crucial role in the development and preservation of the sensory and sympathetic nervous systems. β-NGF also acts as a growth and differentiation factor for B lymphocytes and enhances B-cell survival. The functional form of murine β-NGF is a noncovalently disulfide-linked homodimer, of two 13.4 kDa polypeptide monomers (240 total amino acid residues). The three disulfide bonds are required for biological activity.

r NGF inducible lentiviral particles

LVP659 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing Rat target: NGF (norvegicus nerve growth factor (beta polypeptide)), [alternative names: beta-NGF; Ngfb]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001277055.1. It also contains a RFP-Blasticidin dual selection marker.