Nerve Growth Factor Research

Nerve Growth Factor Life Science reagents:

NGF siRNA

20-abx925868
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • NGF Antibody

    1-CSB-PA942456
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

    NGF Antibody

    DF6061 200ul
    EUR 304.00
    Description: NGF Antibody detects endogenous levels of total NGF.

    NGF Antibody

    ABD6061 100 ug
    EUR 438.00

    NGF Antibody

    48748-100ul 100ul
    EUR 333.00

    NGF Antibody

    48748-50ul 50ul
    EUR 239.00

    NGF-b

    GT15014 100 ug
    EUR 526.00

    NGF antibody

    PAab10116 100 ug
    EUR 355.00

    ELISA kit for Human NGF/NGF Beta

    EK5203 96 tests
    EUR 519.00
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human NGF/NGF Beta in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Mouse NGF/NGF Beta

    EK5204 96 tests
    EUR 519.00
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NGF/NGF Beta in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Rat NGF/NGF Beta

    EK5205 96 tests
    EUR 519.00
    Description: Enzyme-linked immunosorbent assay kit for quantification of Rat NGF/NGF Beta in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human NGF/NGF beta PicoKine ELISA Kit

    EK0469 96 wells
    EUR 425.00
    Description: For quantitative detection of human NGF in cell culture supernates and serum.

    Mouse NGF/NGF beta PicoKine ELISA Kit

    EK0470 96 wells
    EUR 425.00
    Description: For quantitative detection of mouse NGF in cell culture supernates, serum and plasma(heparin, EDTA, citrate).

    Rat NGF/NGF beta PicoKine ELISA Kit

    EK0471 96 wells
    EUR 425.00
    Description: For quantitative detection of in cell culture supernates and serum.

    Anti-NGF/Beta Ngf Rabbit Monoclonal Antibody

    M00341 100ug/vial
    EUR 397.00
    Description: Rabbit Monoclonal NGF/Beta Ngf Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

    Recombinant Mouse beta-NGF/β-NGF Protein

    RP00667 10 μg
    EUR 155.00

    beta-NGF/β-Nerve Growth Factor/β-NGF

    E21-I51 10ug
    EUR 343.00

    beta-NGF/β-Nerve Growth Factor/β-NGF

    E21-K21 10ug
    EUR 343.00

    rHu NGF-beta

    AK8279-0005 5µg EUR 0.00

    rHu NGF-beta

    AK8279-0020 20µg EUR 0.00

    rHu NGF-beta

    AK8279-0100 100µg EUR 0.00

    rHu NGF-beta

    AK8279-1000 1mg EUR 0.00

    NGF Conjugated Antibody

    C48748 100ul
    EUR 397.00

    NGF Conjugated Antibody

    C32048 100ul
    EUR 397.00

    NGF beta Antibody

    AF5172 200ul
    EUR 304.00
    Description: NGF beta Antibody detects endogenous levels of total NGF beta.

    NGF cloning plasmid

    CSB-CL015779HU-10ug 10ug
    EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgtccatgttgttctacactctgatcacagcttttctgatcggcatacaggcggaaccacactcagagagcaatgtccctgcaggacacaccatcccccaagtccactggactaaacttcagcattcccttgacactgcccttcgcagagcccgcagcgccccggcagcggcgat
  • Show more
  • Description: A cloning plasmid for the NGF gene.

    beta NGF antibody

    10R-N127A 500 ug
    EUR 273.00
    Description: Mouse monoclonal beta NGF antibody

    beta NGF protein

    30R-AN001 20 ug
    EUR 273.00
    Description: Purified recombinant Human beta NGF protein

    NGF beta protein

    30R-2354 5 ug
    EUR 224.00
    Description: Purified recombinant Human NGF beta protein

    NGF beta protein

    30R-2553 20 ug
    EUR 353.00
    Description: Purified recombinant Human NGF beta protein

    NGF beta protein

    30R-2554 20 ug
    EUR 336.00
    Description: Purified recombinant Human NGF beta protein

    beta NGF protein

    30R-AB039 20 ug
    EUR 273.00
    Description: Purified recombinant Human beta NGF protein

    NGF Polyclonal Antibody

    41239-100ul 100ul
    EUR 252.00

    NGF Polyclonal Antibody

    41239-50ul 50ul
    EUR 187.00

    NGF Polyclonal Antibody

    41931-100ul 100ul
    EUR 252.00

    NGF Polyclonal Antibody

    41931-50ul 50ul
    EUR 187.00

    NGF beta Antibody

    48321-100ul 100ul
    EUR 333.00

    NGF beta Antibody

    48321-50ul 50ul
    EUR 239.00

    Ngf Polyclonal Antibody

    A52042 100 µg
    EUR 570.55
    Description: reagents widely cited

    NGF Polyclonal Antibody

    A64862 100 µg
    EUR 570.55
    Description: The best epigenetics products

    beta NGF antibody

    70R-NR007 50 ug
    EUR 273.00
    Description: Affinity purified Rabbit polyclonal beta NGF antibody

    NGF Polyclonal Antibody

    ABP53296-003ml 0.03ml
    EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
  • Description: A polyclonal antibody for detection of NGF from Human. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

    NGF Polyclonal Antibody

    ABP53296-01ml 0.1ml
    EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
  • Description: A polyclonal antibody for detection of NGF from Human. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

    NGF Polyclonal Antibody

    ABP53296-02ml 0.2ml
    EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
  • Description: A polyclonal antibody for detection of NGF from Human. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

    NGF beta Antibody

    ABF5172 100 ug
    EUR 438.00

    NGF Polyclonal Antibody

    E-AB-10487-120uL 120uL
    EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is in
  • Show more
  • Description: Rabbit antibody against Human,Mouse,Rat NGF for IHC,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-10487-20uL 20uL
    EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is in
  • Show more
  • Description: Rabbit antibody against Human,Mouse,Rat NGF for IHC,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-10487-60uL 60uL
    EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is in
  • Show more
  • Description: Rabbit antibody against Human,Mouse,Rat NGF for IHC,ELISA applications.

    NGF Blocking Peptide

    DF6061-BP 1mg
    EUR 195.00

    NGF Rabbit pAb

    A14216-100ul 100 ul
    EUR 308.00

    NGF Rabbit pAb

    A14216-200ul 200 ul
    EUR 459.00

    NGF Rabbit pAb

    A14216-20ul 20 ul
    EUR 183.00

    NGF Rabbit pAb

    A14216-50ul 50 ul
    EUR 223.00

    NGF Rabbit pAb

    A13922-100ul 100 ul
    EUR 308.00

    NGF Rabbit pAb

    A13922-200ul 200 ul
    EUR 459.00

    NGF Rabbit pAb

    A13922-20ul 20 ul
    EUR 183.00

    NGF Rabbit pAb

    A13922-50ul 50 ul
    EUR 223.00

    NGF Rabbit pAb

    A0258-100ul 100 ul
    EUR 308.00

    NGF Rabbit pAb

    A0258-200ul 200 ul
    EUR 459.00

    NGF Rabbit pAb

    A0258-20ul 20 ul
    EUR 183.00

    NGF Rabbit pAb

    A0258-50ul 50 ul
    EUR 223.00

    NGF beta antibody

    70R-13739 100 ug
    EUR 322.00
    Description: Affinity purified Rabbit polyclonal NGF beta antibody

    NGF Polyclonal Antibody

    ABP51959-003ml 0.03ml
    EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
  • Description: A polyclonal antibody for detection of NGF from Human, Mouse, Rat. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

    NGF Polyclonal Antibody

    ABP51959-01ml 0.1ml
    EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
  • Description: A polyclonal antibody for detection of NGF from Human, Mouse, Rat. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

    NGF Polyclonal Antibody

    ABP51959-02ml 0.2ml
    EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NGF
  • Applications tips:
  • Description: A polyclonal antibody for detection of NGF from Human, Mouse, Rat. This NGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NGF

    NGF Polyclonal Antibody

    E-AB-32239-120uL 120uL
    EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Nerve growth factor is important for the development and maintenance of the sympathetic and
  • Show more
  • Description: Rabbit antibody against Human,Mouse,Rat NGF for WB,IHC-p,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-32239-20uL 20uL
    EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Nerve growth factor is important for the development and maintenance of the sympathetic and
  • Show more
  • Description: Rabbit antibody against Human,Mouse,Rat NGF for WB,IHC-p,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-32239-60uL 60uL
    EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Nerve growth factor is important for the development and maintenance of the sympathetic and
  • Show more
  • Description: Rabbit antibody against Human,Mouse,Rat NGF for WB,IHC-p,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-33642-120uL 120uL
    EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Nerve growth factor is important for the development and maintenance of the sympathetic and
  • Show more
  • Description: Rabbit antibody against Human NGF for WB,IHC-p,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-33642-20uL 20uL
    EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Nerve growth factor is important for the development and maintenance of the sympathetic and
  • Show more
  • Description: Rabbit antibody against Human NGF for WB,IHC-p,ELISA applications.

    NGF Polyclonal Antibody

    E-AB-33642-60uL 60uL
    EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Nerve growth factor is important for the development and maintenance of the sympathetic and
  • Show more
  • Description: Rabbit antibody against Human NGF for WB,IHC-p,ELISA applications.

    NGF Polyclonal Antibody

    ES2958-100ul 100ul
    EUR 279.00
    Description: A Rabbit Polyclonal antibody against NGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    NGF Polyclonal Antibody

    ES2958-50ul 50ul
    EUR 207.00
    Description: A Rabbit Polyclonal antibody against NGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    NGF Polyclonal Antibody

    ES4295-100ul 100ul
    EUR 279.00
    Description: A Rabbit Polyclonal antibody against NGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    NGF Polyclonal Antibody

    ES4295-50ul 50ul
    EUR 207.00
    Description: A Rabbit Polyclonal antibody against NGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    p75/NGF Receptor

    GT15057 100 ug
    EUR 526.00

    anti- NGF antibody

    FNab10116 100µg
    EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: NGF
  • Uniprot ID: P01138
  • Gene ID: 4803
  • Research Area: Neuroscience, Immunology, Stem cells, Cancer
  • Description: Antibody raised against NGF

    p75/NGF Receptor

    MO15047 100 ug
    EUR 383.00

    Anti-NGF Antibody

    PA1056 100ug/vial
    EUR 294.00

    NGF-b, Mouse

    PR27003 5 ug
    EUR 191.00

    pcDNA3.1-NGF Plasmid

    PVTB00747-2a 2 ug
    EUR 356.00

    Anti-NGF Antibody

    RP1025 100ug/vial
    EUR 294.00

    Anti-NGF antibody

    STJ115857 100 µl
    EUR 277.00
    Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

    Anti-NGF antibody

    STJ116148 100 µl
    EUR 277.00
    Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

    Anti-NGF antibody

    STJ94479 200 µl
    EUR 197.00
    Description: Rabbit polyclonal to NGF.

    Anti-NGF antibody

    STJ97260 200 µl
    EUR 197.00
    Description: NGF is a protein encoded by the NGF gene which is approximately 26,9 kDa. NGF is secreted into the extracellular space. It is involved in apoptotic pathways, p75 NTR receptor-mediated signalling, RET signalling and the GPCR pathway. It is a secreted protein which homodimerizes and is incorporated into a larger complex. It has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. NGF is expressed in the nervous system, blood, eye, adrenal gland and muscle. Mutations in the NGF gene may result in corneal ulcers. STJ97260 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of NGF protein.

    Anti-NGF antibody

    STJ28269 100 µl
    EUR 277.00
    Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

    Anti-NGF antibody

    STJ13100190 100 µg
    EUR 427.00

    Anti-NGF antibody

    STJ13100200 100 µl
    EUR 427.00

    Anti-NGF antibody

    STJ13100203 100 µl
    EUR 427.00

    Anti-NGF antibody

    STJ119971 100 µl
    EUR 413.00
    Description: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis.

    Monkey primate NGF/NGF Beta PicoKine™ ELISA Kit

    EK0469-PR 96 wells
    EUR 425.00
    Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of monkey primate NGF/NGF beta. 96wells/kit, with removable strips.

    beta-NGF/β-Nerve Growth Factor/β-NGF(131-239)

    E21-793 10ug
    EUR 343.00

    Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-100ug

    QP5351-100ug 100ug
    EUR 490.00

    Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-1mg

    QP5351-1mg 1mg
    EUR 2856.00

    Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-20ug

    QP5351-20ug 20ug
    EUR 237.00

    Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-500ug

    QP5351-500ug 500ug
    EUR 1778.00

    Recombinant Human beta-NGF/ Beta-NGF Protein, Untagged, E.coli-5ug

    QP5351-5ug 5ug
    EUR 136.00

    Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-100ug

    QP5412-100ug 100ug
    EUR 490.00

    Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-1mg

    QP5412-1mg 1mg
    EUR 2856.00

    Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-20ug

    QP5412-20ug 20ug
    EUR 237.00

    Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-500ug

    QP5412-500ug 500ug
    EUR 1778.00

    Recombinant Mouse beta-NGF/ Beta-NGF Protein, Untagged, E.coli-5ug

    QP5412-5ug 5ug
    EUR 136.00

    NGF beta Conjugated Antibody

    C48321 100ul
    EUR 397.00

    NGF beta Blocking Peptide

    AF5172-BP 1mg
    EUR 195.00

    Rat NGF shRNA Plasmid

    20-abx989628
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
  • Shipped within 15-20 working days.
  • NGF Antibody, HRP conjugated

    1-CSB-PA643662LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    NGF Antibody, HRP conjugated

    1-CSB-PA643662LB01PI
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Pig. This antibody is HRP conjugated. Tested in the following application: ELISA

    NGF Antibody, FITC conjugated

    1-CSB-PA643662LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    NGF Antibody, FITC conjugated

    1-CSB-PA643662LC01PI
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Pig. This antibody is FITC conjugated. Tested in the following application: ELISA

    NGF Antibody, Biotin conjugated

    1-CSB-PA643662LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    NGF Antibody, Biotin conjugated

    1-CSB-PA643662LD01PI
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against NGF. Recognizes NGF from Pig. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Ngf Antibody, HRP conjugated

    1-CSB-PA16859B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against Ngf. Recognizes Ngf from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

    Ngf Antibody, FITC conjugated

    1-CSB-PA16859C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against Ngf. Recognizes Ngf from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

    Ngf Antibody, Biotin conjugated

    1-CSB-PA16859D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
  • Description: A polyclonal antibody against Ngf. Recognizes Ngf from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

    NGF-beta, human recombinant

    4303-1000
    EUR 4019.00

    NGF-beta, human recombinant

    4303-20
    EUR 294.00

    NGF-beta, human recombinant

    4303R-100
    EUR 697.00

    NGF-beta, human recombinant

    4303R-1000
    EUR 3693.00

    NGF-beta, human recombinant

    4303R-20
    EUR 251.00

    NGF-beta, murine recombinant

    4304-100
    EUR 936.00

    NGF-beta, murine recombinant

    4304-1000
    EUR 5025.00

    NGF-beta, murine recombinant

    4304-20
    EUR 332.00

    NGF-beta, murine recombinant

    4304-5
    EUR 169.00

    NGF recombinant monoclonal antibody

    A5483 100ul X 3
    EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
  • Description: A recombinant monoclonal antibody from rabbit against human NGF for WB, IHC, IF,ELISA

    Mouse NGF beta Protein

    abx060200-100ug 100 ug
    EUR 843.00
  • Shipped within 5-10 working days.
  • Mouse NGF beta Protein

    abx060257-100ug 100 ug
    EUR 843.00
  • Shipped within 5-10 working days.
  • Human NGF-b Protein

    abx060814-20ug 20 ug
    EUR 523.00
  • Shipped within 5-10 working days.
  • NGF beta Blocking Peptide

    20-abx061125
    • EUR 286.00
    • EUR 425.00
    • 1 mg
    • 5 mg
  • Shipped within 5-10 working days.
  • Human NGF shRNA Plasmid

    20-abx953189
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
  • Shipped within 15-20 working days.
  • Mouse NGF shRNA Plasmid

    20-abx971743
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
  • Shipped within 15-20 working days.
  • p75 NGF Receptor Antibody

    48609-100ul 100ul
    EUR 333.00

    p75 NGF Receptor Antibody

    48609-50ul 50ul
    EUR 239.00

    Sheep NGF ELISA Kit

    ESN0021 96Tests
    EUR 521.00

    Porcine NGF ELISA Kit

    EPN0021 96Tests
    EUR 521.00

    Rat NGF ELISA Kit

    ERN0021 96Tests
    EUR 521.00

    Rabbit NGF ELISA Kit

    ERTN0021 96Tests
    EUR 521.00

    Monkey NGF ELISA Kit

    EMKN0021 96Tests
    EUR 521.00

    Mouse NGF ELISA Kit

    EMN0021 96Tests
    EUR 521.00

    Goat NGF ELISA Kit

    EGTN0021 96Tests
    EUR 521.00

    Anserini NGF ELISA Kit

    EAN0021 96Tests
    EUR 521.00

    Bovine NGF ELISA Kit

    EBN0021 96Tests
    EUR 521.00

    Human NGF ELISA Kit

    EHN0021 96Tests
    EUR 521.00

    Human NGF ELISA Kit

    ELA-E0105h 96 Tests
    EUR 824.00

    Chicken NGF ELISA Kit

    ECKN0021 96Tests
    EUR 521.00

    Canine NGF ELISA Kit

    ECN0021 96Tests
    EUR 521.00

    NGF-b, NSO Derived

    PR15083 100 ug
    EUR 422.00

    NGF-b, Human, CHO

    PR27002 5 ug
    EUR 191.00

    pCMV-SPORT6-NGF Plasmid

    PVT16688 2 ug
    EUR 325.00

    Anti-native NGF antibody

    STJ13100189 150 µl
    EUR 427.00

    anti-p75 NGF Receptor

    YF-PA13443 100 ug
    EUR 403.00
    Description: Rabbit polyclonal to p75 NGF Receptor

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-100ug

    QP8881-ec-100ug 100ug
    EUR 571.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-10ug

    QP8881-ec-10ug 10ug
    EUR 272.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-1mg

    QP8881-ec-1mg 1mg
    EUR 2303.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-200ug

    QP8881-ec-200ug 200ug
    EUR 898.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-500ug

    QP8881-ec-500ug 500ug
    EUR 1514.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, E.coli-50ug

    QP8881-ec-50ug 50ug
    EUR 362.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-100ug

    QP9305-ye-100ug 100ug
    EUR 571.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-10ug

    QP9305-ye-10ug 10ug
    EUR 272.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-1mg

    QP9305-ye-1mg 1mg
    EUR 2303.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-200ug

    QP9305-ye-200ug 200ug
    EUR 898.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-500ug

    QP9305-ye-500ug 500ug
    EUR 1505.00

    Recombinant Rat beta-NGF/ Beta-NGF Protein Protein, His, Yeast-50ug

    QP9305-ye-50ug 50ug
    EUR 354.00

    Human NGF/NGF beta EZ-Set™ ELISA Kit (DIY Antibody Pairs)

    EZ0469 5 plates/kit
    EUR 309.00
    Description: For the development of sandwich ELISA kit to measure human NGF/NGF beta in cell culture supernates and serum.

    Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-100ug

    QP7637-ec-100ug 100ug
    EUR 707.00

    Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-10ug

    QP7637-ec-10ug 10ug
    EUR 326.00

    Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-1mg

    QP7637-ec-1mg 1mg
    EUR 2303.00

    Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-200ug

    QP7637-ec-200ug 200ug
    EUR 1115.00

    Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-500ug

    QP7637-ec-500ug 500ug
    EUR 1514.00

    Recombinant Pig beta-NGF/ Beta-NGF Protein Protein, His-SUMO, E.coli-50ug

    QP7637-ec-50ug 50ug
    EUR 435.00

    pro-NGF beta Blocking Peptide

    20-abx162617
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
  • Shipped within 5-10 working days.
  • Nerve Growth Factor (NGF) Antibody

    20-abx101788
    • EUR 356.00
    • EUR 133.00
    • EUR 996.00
    • EUR 495.00
    • EUR 300.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
  • Shipped within 5-7 working days.
  • Nerve Growth Factor (NGF) Antibody

    20-abx131371
    • EUR 398.00
    • EUR 133.00
    • EUR 1080.00
    • EUR 537.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
  • Shipped within 5-7 working days.
  • Anti-NGF -SMCC-DM1 ADC

    ADC-W-1664 1mg EUR 0.00
    Description: This ADC product is comprised of an anti-NGF monoclonal antibody conjugated via a SMCC linker to DM1

    Anti-NGF -SPDB-DM4 ADC

    ADC-W-1665 1mg EUR 0.00
    Description: This ADC product is comprised of an anti-NGF monoclonal antibody conjugated via a SPDB linker to DM4

    Anti-NGF -MC-MMAF ADC

    ADC-W-1666 1mg EUR 0.00
    Description: This ADC product is comprised of an anti-NGF monoclonal antibody conjugated via a MC linker to MMAF

    p75 NGF Receptor Conjugated Antibody

    C48609 100ul
    EUR 397.00

    Active Nerve Growth Factor (NGF)

    4-APA105Hu01
    • EUR 637.60
    • EUR 274.00
    • EUR 2116.00
    • EUR 772.00
    • EUR 1444.00
    • EUR 490.00
    • EUR 5140.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
  • Uniprot ID: P22894
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: 10.1
  • Description: Recombinant Human Nerve Growth Factor expressed in: E.coli

    Active Nerve Growth Factor (NGF)

    4-APA105Ra01
    • EUR 673.44
    • EUR 283.00
    • EUR 2250.40
    • EUR 816.80
    • EUR 1533.60
    • EUR 514.00
    • EUR 5476.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
  • Uniprot ID: P25427
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 9.4
  • Description: Recombinant Rat Nerve Growth Factor expressed in: E.coli

    Ngf Polyclonal Antibody, HRP Conjugated

    A52043 100 µg
    EUR 570.55
    Description: Ask the seller for details

    Ngf Polyclonal Antibody, FITC Conjugated

    A52044 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Ngf Polyclonal Antibody, Biotin Conjugated

    A52045 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    NGF Polyclonal Antibody, HRP Conjugated

    A64863 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    NGF Polyclonal Antibody, FITC Conjugated

    A64864 100 µg
    EUR 570.55
    Description: fast delivery possible

    NGF Polyclonal Antibody, Biotin Conjugated

    A64865 100 µg
    EUR 570.55
    Description: reagents widely cited

    Nerve Growth Factor (NGF) Antibody

    abx033672-400ul 400 ul
    EUR 523.00
  • Shipped within 5-10 working days.
  • Nerve Growth Factor (NGF) Antibody

    abx033672-80l 80 µl
    EUR 286.00
  • Shipped within 5-10 working days.
  • Nerve Growth Factor (NGF) Antibody

    20-abx000643
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
  • Shipped within 5-10 working days.