MYO5C Rabbit Polyclonal Antibody
MYO5C Polyclonal Antibody |
ES9854-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MYO5C from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYO5C Polyclonal Antibody |
ES9854-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MYO5C from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYO5C Rabbit pAb |
A7597-100ul |
Abclonal |
100 ul |
EUR 308 |
MYO5C Rabbit pAb |
A7597-200ul |
Abclonal |
200 ul |
EUR 459 |
MYO5C Rabbit pAb |
A7597-20ul |
Abclonal |
20 ul |
EUR 183 |
MYO5C Rabbit pAb |
A7597-50ul |
Abclonal |
50 ul |
EUR 223 |
MYO5C Antibody |
46065-100ul |
SAB |
100ul |
EUR 252 |
MYO5C Antibody |
46065-50ul |
SAB |
50ul |
EUR 187 |
MYO5C Antibody |
1-CSB-PA873627ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MYO5C. Recognizes MYO5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MYO5C Antibody |
1-CSB-PA873627ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MYO5C. Recognizes MYO5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MYO5C Antibody |
DF9653 |
Affbiotech |
200ul |
EUR 304 |
Description: MYO5C Antibody detects endogenous levels of total MYO5C. |
MYO5C Conjugated Antibody |
C46065 |
SAB |
100ul |
EUR 397 |
Anti-MYO5C antibody |
STJ191012 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MYO5C |
MYO5C siRNA |
20-abx925225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MYO5C |
YF-PA19928 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MYO5C |
MYO5C Blocking Peptide |
DF9653-BP |
Affbiotech |
1mg |
EUR 195 |
MYO5C cloning plasmid |
CSB-CL873627HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1293
- Sequence: atggcggtggccgagctgtacacgcagtacaacagggtctggattcccgatcctgaagaagtttggaagtctgctgaaatagccaaggactacagagttggtgacaaggtcctgcgactcctgctggaggatggaacggagctggattattctgtcaatccagaatctctgcctc
- Show more
|
Description: A cloning plasmid for the MYO5C gene. |
Unconventional Myosin-Vc (MYO5C) Antibody |
20-abx005883 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Unconventional Myosin-Vc (MYO5C) Antibody |
20-abx219260 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Unconventional Myosin-Vc (MYO5C) Antibody |
20-abx320899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Unconventional Myosin-Vc (MYO5C) Antibody |
20-abx320900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human MYO5C shRNA Plasmid |
20-abx961017 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MYO5C ORF Vector (Human) (pORF) |
ORF006851 |
ABM |
1.0 ug DNA |
EUR 95 |
Myo5c ORF Vector (Mouse) (pORF) |
ORF050910 |
ABM |
1.0 ug DNA |
EUR 1572 |
Myo5c sgRNA CRISPR Lentivector set (Mouse) |
K3228001 |
ABM |
3 x 1.0 ug |
EUR 339 |
MYO5C sgRNA CRISPR Lentivector set (Human) |
K1379101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Human Myosin-Vc (MYO5C) |
KTE61415-48T |
Abbkine |
48T |
EUR 332 |
- MYO5C (Myosin VC) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics and Actin Nucleation by ARP-WASP Complex. GO annotations related to this gene include actin binding and actin filament binding. An impor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Myosin-Vc (MYO5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Myosin-Vc (MYO5C) |
KTE61415-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MYO5C (Myosin VC) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics and Actin Nucleation by ARP-WASP Complex. GO annotations related to this gene include actin binding and actin filament binding. An impor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Myosin-Vc (MYO5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Myosin-Vc (MYO5C) |
KTE61415-96T |
Abbkine |
96T |
EUR 539 |
- MYO5C (Myosin VC) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics and Actin Nucleation by ARP-WASP Complex. GO annotations related to this gene include actin binding and actin filament binding. An impor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Myosin-Vc (MYO5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Myo5c sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3228002 |
ABM |
1.0 ug DNA |
EUR 154 |
Myo5c sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3228003 |
ABM |
1.0 ug DNA |
EUR 154 |
Myo5c sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3228004 |
ABM |
1.0 ug DNA |
EUR 154 |
MYO5C sgRNA CRISPR Lentivector (Human) (Target 1) |
K1379102 |
ABM |
1.0 ug DNA |
EUR 154 |
MYO5C sgRNA CRISPR Lentivector (Human) (Target 2) |
K1379103 |
ABM |
1.0 ug DNA |
EUR 154 |
MYO5C sgRNA CRISPR Lentivector (Human) (Target 3) |
K1379104 |
ABM |
1.0 ug DNA |
EUR 154 |
MYO5C Protein Vector (Mouse) (pPB-C-His) |
PV203638 |
ABM |
500 ng |
EUR 2906 |
MYO5C Protein Vector (Mouse) (pPB-N-His) |
PV203639 |
ABM |
500 ng |
EUR 2906 |
MYO5C Rabbit Polyclonal Antibody