MYO5C Rabbit Polyclonal Antibody

MYO5C Rabbit Polyclonal Antibody


MYO5C Polyclonal Antibody

ABP59380-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYO5C protein at amino acid sequence of 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of MYO5C from Human . This MYO5C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5C protein at amino acid sequence of 850-930

MYO5C Polyclonal Antibody

ABP59380-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYO5C protein at amino acid sequence of 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of MYO5C from Human . This MYO5C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5C protein at amino acid sequence of 850-930

MYO5C Rabbit pAb

A7597-100ul 100 ul
EUR 308

MYO5C Rabbit pAb

A7597-200ul 200 ul
EUR 459

MYO5C Rabbit pAb

A7597-20ul 20 ul
EUR 183

MYO5C Rabbit pAb

A7597-50ul 50 ul
EUR 223

MYO5C Antibody

ABD9653 100 ug
EUR 438

MYO5C Antibody

46065-100ul 100ul
EUR 252

MYO5C Antibody

46065-50ul 50ul
EUR 187

MYO5C Antibody

DF9653 200ul
EUR 304
Description: MYO5C Antibody detects endogenous levels of total MYO5C.

MYO5C Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYO5C. Recognizes MYO5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MYO5C Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYO5C. Recognizes MYO5C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MYO5C Conjugated Antibody

C46065 100ul
EUR 397

Anti-MYO5C antibody

STJ29734 100 µl
EUR 277

Anti-MYO5C antibody

STJ191012 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYO5C


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19928 50 ug
EUR 363
Description: Mouse polyclonal to MYO5C

MYO5C cloning plasmid

CSB-CL873627HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggcggtggccgagctgtacacgcagtacaacagggtctggattcccgatcctgaagaagtttggaagtctgctgaaatagccaaggactacagagttggtgacaaggtcctgcgactcctgctggaggatggaacggagctggattattctgtcaatccagaatctctgcctc
  • Show more
Description: A cloning plasmid for the MYO5C gene.

MYO5C Blocking Peptide

DF9653-BP 1mg
EUR 195

Unconventional Myosin-Vc (MYO5C) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Unconventional Myosin-Vc (MYO5C) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Unconventional Myosin-Vc (MYO5C) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Unconventional Myosin-Vc (MYO5C) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human MYO5C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MYO5C ORF Vector (Human) (pORF)

ORF006851 1.0 ug DNA
EUR 95

Myo5c ORF Vector (Mouse) (pORF)

ORF050910 1.0 ug DNA
EUR 1572

Human Myosin- Vc, MYO5C ELISA KIT

ELI-19970h 96 Tests
EUR 824

MYO5C sgRNA CRISPR Lentivector set (Human)

K1379101 3 x 1.0 ug
EUR 339

Myo5c sgRNA CRISPR Lentivector set (Mouse)

K3228001 3 x 1.0 ug
EUR 339

Human Myosin VC(MYO5C)ELISA Kit

QY-E03041 96T
EUR 361

MYO5C sgRNA CRISPR Lentivector (Human) (Target 1)

K1379102 1.0 ug DNA
EUR 154

MYO5C sgRNA CRISPR Lentivector (Human) (Target 2)

K1379103 1.0 ug DNA
EUR 154

MYO5C sgRNA CRISPR Lentivector (Human) (Target 3)

K1379104 1.0 ug DNA
EUR 154

Myo5c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3228002 1.0 ug DNA
EUR 154

Myo5c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3228003 1.0 ug DNA
EUR 154

Myo5c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3228004 1.0 ug DNA
EUR 154

ELISA kit for Human Myosin-Vc (MYO5C)

KTE61415-48T 48T
EUR 332
  • MYO5C (Myosin VC) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics and Actin Nucleation by ARP-WASP Complex. GO annotations related to this gene include actin binding and actin filament binding. An impor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-Vc (MYO5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-Vc (MYO5C)

KTE61415-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MYO5C (Myosin VC) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics and Actin Nucleation by ARP-WASP Complex. GO annotations related to this gene include actin binding and actin filament binding. An impor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-Vc (MYO5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Myosin-Vc (MYO5C)

KTE61415-96T 96T
EUR 539
  • MYO5C (Myosin VC) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics and Actin Nucleation by ARP-WASP Complex. GO annotations related to this gene include actin binding and actin filament binding. An impor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Myosin-Vc (MYO5C) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MYO5C Protein Vector (Human) (pPB-C-His)

PV027401 500 ng
EUR 329

MYO5C Protein Vector (Human) (pPB-N-His)

PV027402 500 ng
EUR 329

MYO5C Rabbit Polyclonal Antibody