MYO5B Rabbit Polyclonal Antibody
MYO5B Polyclonal Antibody |
ABP59379-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of MYO5B from Human, Mouse, Rat. This MYO5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200 |
MYO5B Polyclonal Antibody |
ABP59379-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of MYO5B from Human, Mouse, Rat. This MYO5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200 |
MYO5B Polyclonal Antibody |
ABP59379-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of MYO5B from Human, Mouse, Rat. This MYO5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200 |
MYO5B Polyclonal Antibody |
ES9853-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MYO5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYO5B Polyclonal Antibody |
ES9853-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MYO5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYO5B Rabbit pAb |
A8558-100ul |
Abclonal |
100 ul |
EUR 308 |
MYO5B Rabbit pAb |
A8558-200ul |
Abclonal |
200 ul |
EUR 459 |
MYO5B Rabbit pAb |
A8558-20ul |
Abclonal |
20 ul |
EUR 183 |
MYO5B Rabbit pAb |
A8558-50ul |
Abclonal |
50 ul |
EUR 223 |
MYO5B Polyclonal Conjugated Antibody |
C31599 |
SAB |
100ul |
EUR 397 |
MYO5B Antibody |
1-CSB-PA892471ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MYO5B. Recognizes MYO5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
MYO5B Antibody |
1-CSB-PA892471ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MYO5B. Recognizes MYO5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal MYO5B Antibody (N-Term) |
APR17509G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYO5B (N-Term). This antibody is tested and proven to work in the following applications: |
Anti-MYO5B antibody |
STJ111294 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. |
Anti-MYO5B antibody |
STJ191011 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MYO5B |
MYO5B siRNA |
20-abx925223 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYO5B siRNA |
20-abx925224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal MYO5B / Myosin VB Antibody (N-Terminus) |
APR17508G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYO5B / Myosin VB (N-Terminus). This antibody is tested and proven to work in the following applications: |
MYO5B cloning plasmid |
CSB-CL892471HU-10ug |
Cusabio |
10ug |
EUR 461 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1257
- Sequence: ATGAAGAAAGCCCAGGACCTAGAAGCTGCCCAGGCATTGGCCCAGAGTGAGAGGAAGCGCCATGAGCTCAACAGGCAGGTCACGGTCCAGCGGAAAGAGAAGGATTTCCAGGGCATGCTGGAGTACCACAAAGAGGACGAGGCCCTCCTCATCCGGAACCTGGTGACAGACTTGA
- Show more
|
Description: A cloning plasmid for the MYO5B gene. |
Unconventional Myosin-Vb (MYO5B) Antibody |
20-abx124250 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Unconventional Myosin-Vb (MYO5B) Antibody |
abx146000-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Unconventional Myosin-Vb (MYO5B) Antibody |
20-abx321118 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Unconventional Myosin-Vb (MYO5B) Antibody |
20-abx321975 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rat MYO5B shRNA Plasmid |
20-abx984812 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MYO5B shRNA Plasmid |
20-abx953069 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Myo5b ORF Vector (Rat) (pORF) |
ORF071016 |
ABM |
1.0 ug DNA |
EUR 2080 |
MYO5B ORF Vector (Human) (pORF) |
ORF013845 |
ABM |
1.0 ug DNA |
EUR 354 |
Myo5b ORF Vector (Mouse) (pORF) |
ORF050909 |
ABM |
1.0 ug DNA |
EUR 1572 |
Myo5b sgRNA CRISPR Lentivector set (Rat) |
K6879701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Myo5b sgRNA CRISPR Lentivector set (Mouse) |
K3655101 |
ABM |
3 x 1.0 ug |
EUR 339 |
MYO5B sgRNA CRISPR Lentivector set (Human) |
K1379001 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Rat Myosin-Vb (MYO5B) |
KTE100541-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MYO5B, together with other proteins, may be involved in plasma membrane recycling. Mutations in MYO5B are associated with microvillous inclusion disease.
|
Description: Quantitative sandwich ELISA for measuring Rat Myosin-Vb (MYO5B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Myosin-Vb (MYO5B) |
KTE100541-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MYO5B, together with other proteins, may be involved in plasma membrane recycling. Mutations in MYO5B are associated with microvillous inclusion disease.
|
Description: Quantitative sandwich ELISA for measuring Rat Myosin-Vb (MYO5B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Myosin-Vb (MYO5B) |
KTE100541-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MYO5B, together with other proteins, may be involved in plasma membrane recycling. Mutations in MYO5B are associated with microvillous inclusion disease.
|
Description: Quantitative sandwich ELISA for measuring Rat Myosin-Vb (MYO5B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Myo5b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6879702 |
ABM |
1.0 ug DNA |
EUR 154 |
Myo5b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6879703 |
ABM |
1.0 ug DNA |
EUR 154 |
Myo5b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6879704 |
ABM |
1.0 ug DNA |
EUR 154 |
MYO5B Rabbit Polyclonal Antibody