MYO5B Rabbit Polyclonal Antibody

MYO5B Rabbit Polyclonal Antibody

 

MYO5B Polyclonal Antibody
ABP59379-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of MYO5B from Human, Mouse, Rat. This MYO5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200

MYO5B Polyclonal Antibody
ABP59379-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of MYO5B from Human, Mouse, Rat. This MYO5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200

MYO5B Polyclonal Antibody
ABP59379-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of MYO5B from Human, Mouse, Rat. This MYO5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO5B protein at amino acid sequence of 1120-1200

MYO5B Polyclonal Antibody
ES9853-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYO5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO5B Polyclonal Antibody
ES9853-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYO5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO5B Rabbit pAb
A8558-100ul 100 ul
EUR 308

MYO5B Rabbit pAb
A8558-200ul 200 ul
EUR 459

MYO5B Rabbit pAb
A8558-20ul 20 ul
EUR 183

MYO5B Rabbit pAb
A8558-50ul 50 ul
EUR 223

MYO5B Polyclonal Conjugated Antibody
C31599 100ul
EUR 397

MYO5B Antibody
1-CSB-PA892471ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYO5B. Recognizes MYO5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MYO5B Antibody
1-CSB-PA892471ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYO5B. Recognizes MYO5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal MYO5B Antibody (N-Term)
APR17509G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYO5B (N-Term). This antibody is tested and proven to work in the following applications:

Myo5b/ Rat Myo5b ELISA Kit
ELI-19969r 96 Tests
EUR 886

Anti-MYO5B antibody
STJ111294 100 µl
EUR 277
Description: The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease.

Anti-MYO5B antibody
STJ191011 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYO5B

MYO5B siRNA
20-abx925223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYO5B siRNA
20-abx925224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal MYO5B / Myosin VB Antibody (N-Terminus)
APR17508G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYO5B / Myosin VB (N-Terminus). This antibody is tested and proven to work in the following applications:

MYO5B cloning plasmid
CSB-CL892471HU-10ug 10ug
EUR 461
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1257
  • Sequence: ATGAAGAAAGCCCAGGACCTAGAAGCTGCCCAGGCATTGGCCCAGAGTGAGAGGAAGCGCCATGAGCTCAACAGGCAGGTCACGGTCCAGCGGAAAGAGAAGGATTTCCAGGGCATGCTGGAGTACCACAAAGAGGACGAGGCCCTCCTCATCCGGAACCTGGTGACAGACTTGA
  • Show more
Description: A cloning plasmid for the MYO5B gene.

Unconventional Myosin-Vb (MYO5B) Antibody
20-abx124250
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Unconventional Myosin-Vb (MYO5B) Antibody
abx146000-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Unconventional Myosin-Vb (MYO5B) Antibody
20-abx321118
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Unconventional Myosin-Vb (MYO5B) Antibody
20-abx321975
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat MYO5B shRNA Plasmid
20-abx984812
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MYO5B shRNA Plasmid
20-abx953069
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Myo5b ORF Vector (Rat) (pORF)
ORF071016 1.0 ug DNA
EUR 2080

MYO5B ORF Vector (Human) (pORF)
ORF013845 1.0 ug DNA
EUR 354

Myo5b ORF Vector (Mouse) (pORF)
ORF050909 1.0 ug DNA
EUR 1572

Human Myosin- Vb, MYO5B ELISA KIT
ELI-16124h 96 Tests
EUR 824

Mouse Myosin- Vb, Myo5b ELISA KIT
ELI-19968m 96 Tests
EUR 865

Myo5b sgRNA CRISPR Lentivector set (Rat)
K6879701 3 x 1.0 ug
EUR 339

Myo5b sgRNA CRISPR Lentivector set (Mouse)
K3655101 3 x 1.0 ug
EUR 339

MYO5B sgRNA CRISPR Lentivector set (Human)
K1379001 3 x 1.0 ug
EUR 339

ELISA kit for Rat Myosin-Vb (MYO5B)
KTE100541-48T 48T
EUR 332
  • The protein encoded by MYO5B, together with other proteins, may be involved in plasma membrane recycling. Mutations in MYO5B are associated with microvillous inclusion disease.
Description: Quantitative sandwich ELISA for measuring Rat Myosin-Vb (MYO5B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Myosin-Vb (MYO5B)
KTE100541-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MYO5B, together with other proteins, may be involved in plasma membrane recycling. Mutations in MYO5B are associated with microvillous inclusion disease.
Description: Quantitative sandwich ELISA for measuring Rat Myosin-Vb (MYO5B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Myosin-Vb (MYO5B)
KTE100541-96T 96T
EUR 539
  • The protein encoded by MYO5B, together with other proteins, may be involved in plasma membrane recycling. Mutations in MYO5B are associated with microvillous inclusion disease.
Description: Quantitative sandwich ELISA for measuring Rat Myosin-Vb (MYO5B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Myo5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6879702 1.0 ug DNA
EUR 154

Myo5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6879703 1.0 ug DNA
EUR 154

Myo5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6879704 1.0 ug DNA
EUR 154

MYO5B Rabbit Polyclonal Antibody