MYO1F Rabbit Polyclonal Antibody

MYO1F Rabbit Polyclonal Antibody

 

MYO1F Polyclonal Antibody

ABP59376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of MYO1F from Human, Mouse. This MYO1F antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYO1F protein at amino acid sequence of 640-720

MYO1F Antibody

ABD2210 100 ug
EUR 438

MYO1F Antibody

44670-100ul 100ul
EUR 252

MYO1F Antibody

44670-50ul 50ul
EUR 187

MYO1F Antibody

DF2210 200ul
EUR 304
Description: MYO1F antibody detects endogenous levels of total MYO1F.

Myosin IF (MYO1F) Polyclonal Antibody (Human)

4-PAD435Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Rat)

4-PAD435Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F)

MYO1F Conjugated Antibody

C44670 100ul
EUR 397

Anti-MYO1F antibody

STJ191009 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYO1F

MYO1F siRNA

20-abx925215
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC

4-PAD435Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Biotinylated

4-PAD435Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Cy3

4-PAD435Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Human), FITC

4-PAD435Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), HRP

4-PAD435Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Human), PE

4-PAD435Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC

4-PAD435Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Biotinylated

4-PAD435Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Cy3

4-PAD435Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), FITC

4-PAD435Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), HRP

4-PAD435Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), PE

4-PAD435Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Antibody

20-abx130219
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

abx036673-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx100606
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

20-abx177687
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

20-abx217018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC-Cy7

4-PAD435Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC-Cy7

4-PAD435Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

MYO1F cloning plasmid

CSB-CL015343HU-10ug 10ug
EUR 1209
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3297
  • Sequence: atgggcagcaaggagcgcttccactggcagagccacaacgtgaagcagagcggcgtggatgacatggtgcttcttccccagatcaccgaagacgccattgccgccaacctccggaagcgcttcatggacgactacatcttcacctacatcggctctgtgctcatctctgtaaacc
  • Show more
Description: A cloning plasmid for the MYO1F gene.

MYO1F Blocking Peptide

DF2210-BP 1mg
EUR 195

Human MYO1F shRNA Plasmid

20-abx953012
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Myosin IF (MYO1F)

4-RPD435Hu01
  • EUR 479.90
  • EUR 232.00
  • EUR 1524.64
  • EUR 574.88
  • EUR 1049.76
  • EUR 384.00
  • EUR 3661.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00160
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Myosin IF expressed in: E.coli

Recombinant Myosin IF (MYO1F)

4-RPD435Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A7X9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 9.9
Description: Recombinant Rat Myosin IF expressed in: E.coli

Human Myosin IF (MYO1F) Protein

20-abx068162
  • EUR 676.00
  • EUR 272.00
  • EUR 2054.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Myosin IF (MYO1F) Protein

20-abx167674
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MYO1F ORF Vector (Human) (pORF)

ORF006850 1.0 ug DNA
EUR 95

Myo1f ORF Vector (Mouse) (pORF)

ORF050903 1.0 ug DNA
EUR 506

MYO1F Rabbit Polyclonal Antibody