MYO1F Rabbit Polyclonal Antibody

MYO1F Rabbit Polyclonal Antibody

 

MYO1F Polyclonal Antibody

ES9851-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYO1F from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYO1F Antibody

44670-100ul 100ul
EUR 252

MYO1F Antibody

44670-50ul 50ul
EUR 187

MYO1F Antibody

DF2210 200ul
EUR 304
Description: MYO1F antibody detects endogenous levels of total MYO1F.

MYO1F Antibody

ABD2210 100 ug
EUR 438

Myosin IF (MYO1F) Polyclonal Antibody (Human)

4-PAD435Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F)

Myosin IF (MYO1F) Polyclonal Antibody (Rat)

4-PAD435Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F)

MYO1F Conjugated Antibody

C44670 100ul
EUR 397

Anti-MYO1F antibody

STJ191009 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYO1F

MYO1F siRNA

20-abx925215
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC

4-PAD435Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Biotinylated

4-PAD435Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Human), Cy3

4-PAD435Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Human), FITC

4-PAD435Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Human), HRP

4-PAD435Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Human), PE

4-PAD435Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC

4-PAD435Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Biotinylated

4-PAD435Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Biotin.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), Cy3

4-PAD435Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with Cy3.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), FITC

4-PAD435Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with FITC.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), HRP

4-PAD435Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with HRP.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), PE

4-PAD435Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with PE.

Myosin IF (MYO1F) Antibody

20-abx217018
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx177687
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

20-abx100606
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Antibody

abx036673-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Myosin IF (MYO1F) Antibody

20-abx130219
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin IF (MYO1F) Polyclonal Antibody (Human), APC-Cy7

4-PAD435Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (Glu491~Ser767)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

Myosin IF (MYO1F) Polyclonal Antibody (Rat), APC-Cy7

4-PAD435Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYO1F (His655~Ser922)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Myosin IF (MYO1F). This antibody is labeled with APC-Cy7.

MYO1F Blocking Peptide

DF2210-BP 1mg
EUR 195

MYO1F cloning plasmid

CSB-CL015343HU-10ug 10ug
EUR 1209
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3297
  • Sequence: atgggcagcaaggagcgcttccactggcagagccacaacgtgaagcagagcggcgtggatgacatggtgcttcttccccagatcaccgaagacgccattgccgccaacctccggaagcgcttcatggacgactacatcttcacctacatcggctctgtgctcatctctgtaaacc
  • Show more
Description: A cloning plasmid for the MYO1F gene.

Human MYO1F shRNA Plasmid

20-abx953012
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Myosin IF (MYO1F)

4-RPD435Hu01
  • EUR 479.90
  • EUR 232.00
  • EUR 1524.64
  • EUR 574.88
  • EUR 1049.76
  • EUR 384.00
  • EUR 3661.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00160
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Myosin IF expressed in: E.coli

Recombinant Myosin IF (MYO1F)

4-RPD435Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A7X9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 9.9
Description: Recombinant Rat Myosin IF expressed in: E.coli

Rat Myosin IF (MYO1F) Protein

20-abx167674
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Myosin IF (MYO1F) Protein

20-abx068162
  • EUR 676.00
  • EUR 272.00
  • EUR 2054.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myo1f ORF Vector (Rat) (pORF)

ORF071012 1.0 ug DNA
EUR 506

MYO1F ORF Vector (Human) (pORF)

ORF006850 1.0 ug DNA
EUR 95

MYO1F Rabbit Polyclonal Antibody