MYO10 Rabbit Polyclonal Antibody

MYO10 Rabbit Polyclonal Antibody

 

MYO10 Polyclonal Antibody

ES9856-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYO10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Myosin X (MYO10) ELISA Kit

DLR-MYO10-Hu-48T 48T
EUR 517
  • Should the Human Myosin X (MYO10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Myosin X (MYO10) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin X (MYO10) ELISA Kit

DLR-MYO10-Hu-96T 96T
EUR 673
  • Should the Human Myosin X (MYO10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Myosin X (MYO10) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin X (MYO10) ELISA Kit

RDR-MYO10-Hu-48Tests 48 Tests
EUR 544

Human Myosin X (MYO10) ELISA Kit

RDR-MYO10-Hu-96Tests 96 Tests
EUR 756

Human Myosin X (MYO10) ELISA Kit

RD-MYO10-Hu-48Tests 48 Tests
EUR 521

Human Myosin X (MYO10) ELISA Kit

RD-MYO10-Hu-96Tests 96 Tests
EUR 723

MYO10 Rabbit pAb

A12466-100ul 100 ul
EUR 308

MYO10 Rabbit pAb

A12466-200ul 200 ul
EUR 459

MYO10 Rabbit pAb

A12466-20ul 20 ul
EUR 183

MYO10 Rabbit pAb

A12466-50ul 50 ul
EUR 223

MYO10 Rabbit pAb

A12471-100ul 100 ul
EUR 308

MYO10 Rabbit pAb

A12471-200ul 200 ul
EUR 459

MYO10 Rabbit pAb

A12471-20ul 20 ul
EUR 183

MYO10 Rabbit pAb

A12471-50ul 50 ul
EUR 223

MYO10 Rabbit pAb

A8439-100ul 100 ul
EUR 308

MYO10 Rabbit pAb

A8439-200ul 200 ul
EUR 459

MYO10 Rabbit pAb

A8439-20ul 20 ul
EUR 183

MYO10 Rabbit pAb

A8439-50ul 50 ul
EUR 223

MYO10 Antibody

47866-100ul 100ul
EUR 252

MYO10 Antibody

1-CSB-PA884628LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYO10. Recognizes MYO10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MYO10 Polyclonal Antibody, HRP Conjugated

A62999 100 µg
EUR 570.55
Description: fast delivery possible

MYO10 Polyclonal Antibody, FITC Conjugated

A63000 100 µg
EUR 570.55
Description: kits suitable for this type of research

MYO10 Polyclonal Antibody, Biotin Conjugated

A63001 100 µg
EUR 570.55
Description: fast delivery possible

Polyclonal MYO10 / Myosin-X Antibody (Internal)

APR17504G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYO10 / Myosin-X (Internal). This antibody is tested and proven to work in the following applications:

MYO10 Conjugated Antibody

C47866 100ul
EUR 397

anti- MYO10 antibody

FNab05498 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: myosin X
  • Uniprot ID: Q9HD67
  • Gene ID: 4651
  • Research Area: Signal Transduction
Description: Antibody raised against MYO10

Anti-MYO10 antibody

PAab05498 100 ug
EUR 386

Anti-MYO10 antibody

STJ110737 100 µl
EUR 277
Description: This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis.

Anti-MYO10 antibody

STJ114340 100 µl
EUR 277
Description: This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis.

Anti-MYO10 antibody

STJ114345 100 µl
EUR 277
Description: This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis.

Anti-MYO10 antibody

STJ191014 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYO10

MYO10 siRNA

20-abx903428
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYO10 siRNA

20-abx925194
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYO10 siRNA

20-abx925195
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYO10 Antibody, HRP conjugated

1-CSB-PA884628LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYO10. Recognizes MYO10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYO10 Antibody, FITC conjugated

1-CSB-PA884628LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYO10. Recognizes MYO10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYO10 Antibody, Biotin conjugated

1-CSB-PA884628LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYO10. Recognizes MYO10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Myosin X (MYO10) Antibody

20-abx005836
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin X (MYO10) Antibody

abx235498-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Myosin X (MYO10) Antibody

20-abx333927
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MYO10 cloning plasmid

CSB-CL884628HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 294
  • Sequence: atggataacttcttcaccgagggaacacgggtctggctgagagaaaatggccagcattttccaagtactgtaaattcctgtgcagaaggcatcgtcgtcttccggacagactatggtcaggtattcacttacaagcagagcacaattacccaccagaaggtgactgctatgcaccc
  • Show more
Description: A cloning plasmid for the MYO10 gene.

Myosin X (MYO10) Antibody (HRP)

20-abx338248
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MYO10 Rabbit Polyclonal Antibody