MUC7 Rabbit Polyclonal Antibody

MUC7 Rabbit Polyclonal Antibody

 

MUC7 Polyclonal Antibody
ES9828-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC7 Polyclonal Antibody
ES9828-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Mucin 7, Secreted (MUC7) ELISA Kit
DLR-MUC7-Hu-48T	DL Develop	48T	EUR 498
Should the Human Mucin 7, Secreted (MUC7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
DLR-MUC7-Hu-96T	DL Develop	96T	EUR 647
Should the Human Mucin 7, Secreted (MUC7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
RDR-MUC7-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Mucin 7, Secreted (MUC7) ELISA Kit
RDR-MUC7-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Mucin 7, Secreted (MUC7) ELISA Kit
RD-MUC7-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Mucin 7, Secreted (MUC7) ELISA Kit
RD-MUC7-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

MUC7 Antibody
43220-100ul	SAB	100ul	EUR 252

MUC7 Antibody
1-CSB-PA949093	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC7 Antibody
1-CSB-PA780399	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

MUC7 Antibody
DF9642	Affbiotech	200ul	EUR 304
Description: MUC7 Antibody detects endogenous levels of total MUC7.

MUC7 Antibody
ABD9642	Lifescience Market	100 ug	EUR 438

Rabbit MUC7 ELISA Kit
ERTM0361	Abclonal	96Tests	EUR 521

Anti-MUC7 Antibody
A05210	BosterBio	100ug/vial	EUR 294

MUC7 Conjugated Antibody
C43220	SAB	100ul	EUR 397

Anti-MUC7 antibody
STJ190986	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MUC7

MUC7 siRNA
20-abx925029	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-MUC7
YF-PA24185	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MUC7

Mucin 7 (MUC7) Antibody
abx216981-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody
20-abx210446	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody
20-abx210681	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Rabbit Mucin-7, Secreted (MUC7) ELISA Kit
abx363009-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

MUC7 Blocking Peptide
DF9642-BP	Affbiotech	1mg	EUR 195

MUC7 cloning plasmid
CSB-CL851529HU-10ug	Cusabio	10ug	EUR 427
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1134 Sequence: atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttca Show more
Description: A cloning plasmid for the MUC7 gene.

Anti-MUC7 (7F2)
YF-MA10594	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MUC7

Anti-MUC7 (1C10)
YF-MA14331	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MUC7

Mucin 7, Secreted (MUC7) Antibody
20-abx177629	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Mucin 7, Secreted (MUC7) Antibody
20-abx177630	Abbexa	EUR 1358.00 EUR 648.00	1 mg 200 ug
Please enquire.

Mucin 7, Secreted (MUC7) Antibody
20-abx173632	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Human MUC7 ELISA Kit
ELA-E1808h	Lifescience Market	96 Tests	EUR 824

Human MUC7 ELISA Kit
EHM0361	Abclonal	96Tests	EUR 521

Bovine MUC7 ELISA Kit
EBM0361	Abclonal	96Tests	EUR 521

Anserini MUC7 ELISA Kit
EAM0361	Abclonal	96Tests	EUR 521

Chicken MUC7 ELISA Kit
ECKM0361	Abclonal	96Tests	EUR 521

Canine MUC7 ELISA Kit
ECM0361	Abclonal	96Tests	EUR 521

Goat MUC7 ELISA Kit
EGTM0361	Abclonal	96Tests	EUR 521

MUC7 ELISA KIT|Human
EF006051	Lifescience Market	96 Tests	EUR 689

Human MUC7 shRNA Plasmid
20-abx953023	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine MUC7 ELISA Kit
EPM0361	Abclonal	96Tests	EUR 521

Sheep MUC7 ELISA Kit
ESM0361	Abclonal	96Tests	EUR 521

Rat MUC7 ELISA Kit
ERM0361	Abclonal	96Tests	EUR 521

Monkey MUC7 ELISA Kit
EMKM0361	Abclonal	96Tests	EUR 521

Mouse MUC7 ELISA Kit
EMM0361	Abclonal	96Tests	EUR 521

pCMV-SPORT6-MUC7 Plasmid
PVT16340	Lifescience Market	2 ug	EUR 325

MUC7 Recombinant Protein (Human)
RP020392	ABM	100 ug	Ask for price

Monoclonal MUC7 Antibody (monoclonal) (M06), Clone: 7F2
AMM03823G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MUC7 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 7F2. This antibody is applicable in WB, E

Guinea Pig MUC7 ELISA Kit
EGM0361	Abclonal	96Tests	EUR 521

MUC7 ORF Vector (Human) (pORF)
ORF006798	ABM	1.0 ug DNA	EUR 95

Recombinant Mucin 7, Secreted (MUC7)
4-RPB808Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 66.8kDa Isoelectric Point: 8.2
Description: Recombinant Human Recombinant Mucin 7, Secreted (MUC7) expressed in: E.coli

MUC7 ELISA Kit (Human) (OKEH01290)
OKEH01290	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. This antimicrobial protein has antibacterial and antifungal activity. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15 ng/mL

Human Mucin-7,MUC7 ELISA Kit
201-12-1614	SunredBio	96 tests	EUR 440
This Mucin-7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucin 7 (MUC7) CLIA Kit
abx197312-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human MUC7/ Mucin-7 ELISA Kit
E1675Hu	Sunlong	1 Kit	EUR 571

Human MUC7(Mucin-7) ELISA Kit
EH1942	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q8TAX7 Alias: MUC7/MG2/MUC-7/Apo-MG2/Salivary mucin-7
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- 7, MUC7 ELISA KIT
ELI-05843h	Lifescience Market	96 Tests	EUR 824

Human Mucin-7, MUC7 ELISA Kit
CSB-E11853h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-7, MUC7 ELISA Kit
1-CSB-E11853h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin 7, Secreted (MUC7) Protein
20-abx654412	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Mucin-7(MUC7)ELISA Kit
GA-E1630HM-48T	GenAsia Biotech	48T	EUR 289

Human Mucin-7(MUC7)ELISA Kit
GA-E1630HM-96T	GenAsia Biotech	96T	EUR 466

Mouse Mucin-7(MUC7)ELISA Ki
GA-E0485MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Mucin-7(MUC7)ELISA Ki
GA-E0485MS-96T	GenAsia Biotech	96T	EUR 534

MUC7 sgRNA CRISPR Lentivector set (Human)
K1367301	ABM	3 x 1.0 ug	EUR 339

Human Mucin-7(MUC7)ELISA Kit
QY-E00294	Qayee Biotechnology	96T	EUR 361

CLIA kit for Human MUC7 (Mucin 7)
E-CL-H1342	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's MUC7 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human MUC7 (Mucin 7)
E-EL-H2281	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse MUC7 (Mucin-7)
E-EL-M0801	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse MUC7 (Mucin-7) in samples from Serum, Plasma, Cell supernatant

Human Mucin-7, Secreted (MUC7) ELISA Kit
20-abx152403	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit
abx251263-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Pig Mucin-7, Secreted (MUC7) ELISA Kit
abx361133-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Mucin-7, Secreted (MUC7) ELISA Kit
abx350994-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Mucin-7, Secreted (MUC7) ELISA Kit
abx355984-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Mucin-7, Secreted (MUC7) ELISA Kit
abx359170-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit
abx572156-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Mucin-7, Secreted (MUC7) CLIA Kit
20-abx493103	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human Mucin-7 (MUC7)
KTE61449-48T	Abbkine	48T	EUR 354
MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)
KTE61449-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)
KTE61449-96T	Abbkine	96T	EUR 572
MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MUC7 sgRNA CRISPR Lentivector (Human) (Target 1)
K1367302	ABM	1.0 ug DNA	EUR 154

MUC7 sgRNA CRISPR Lentivector (Human) (Target 2)
K1367303	ABM	1.0 ug DNA	EUR 154

MUC7 sgRNA CRISPR Lentivector (Human) (Target 3)
K1367304	ABM	1.0 ug DNA	EUR 154

ELISA kit for Mouse Mucin-7 (MUC7)
KTE71571-48T	Abbkine	48T	EUR 332
The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)
KTE71571-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)
KTE71571-96T	Abbkine	96T	EUR 539
The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MUC7 Protein Vector (Human) (pPB-C-His)
PV027189	ABM	500 ng	EUR 329

MUC7 Protein Vector (Human) (pPB-N-His)
PV027190	ABM	500 ng	EUR 329

MUC7 Protein Vector (Human) (pPM-C-HA)
PV027191	ABM	500 ng	EUR 329

MUC7 Protein Vector (Human) (pPM-C-His)
PV027192	ABM	500 ng	EUR 329

Human Mucin 7, Secreted ELISA Kit (MUC7)
RK01900	Abclonal	96 Tests	EUR 521

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
SEB808Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit
4-SEB808Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mucin 7, Secreted elisa. Alternative names of the recognized antigen: MG2 Mucin 7, Salivary Apo-MG2 Salivary mucin-7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

MUC7 3'UTR GFP Stable Cell Line
TU064966	ABM	1.0 ml	EUR 1394

MUC7 3'UTR Luciferase Stable Cell Line
TU014966	ABM	1.0 ml	EUR 1394

ELISA kit for Human MUC7 (Mucin 7, Secreted)
ELK2203	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 7, Secreted (MUC7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 7, Show more
Description: A sandwich ELISA kit for detection of Mucin 7, Secreted from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Mucin-7, Secreted (MUC7) ELISA Kit
abx357346-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MUC7 Rabbit Polyclonal Antibody