MRAP Rabbit Polyclonal Antibody

MRAP Rabbit Polyclonal Antibody

 

MRAP Polyclonal Antibody

ABP59321-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MRAP protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of MRAP from Human. This MRAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MRAP protein at amino acid sequence of 20-100

MRAP Polyclonal Antibody

ABP59321-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MRAP protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of MRAP from Human. This MRAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MRAP protein at amino acid sequence of 20-100

MRAP Polyclonal Antibody

ABP59321-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MRAP protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of MRAP from Human. This MRAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MRAP protein at amino acid sequence of 20-100

MRAP Antibody

ABD9621 100 ug
EUR 438

MRAP Antibody

46041-100ul 100ul
EUR 252

MRAP Antibody

46041-50ul 50ul
EUR 187

MRAP antibody

70R-18587 50 ul
EUR 435
Description: Rabbit polyclonal MRAP antibody

MRAP Antibody

DF9621 200ul
EUR 304
Description: MRAP Antibody detects endogenous levels of total MRAP.

MRAP Antibody

1-CSB-PA851545LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MRAP. Recognizes MRAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MRAP Antibody

1-CSB-PA014779GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MRAP. Recognizes MRAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal MRAP Antibody (N-term)

APR08512G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MRAP (N-term). This antibody is tested and proven to work in the following applications:

MRAP Conjugated Antibody

C46041 100ul
EUR 397

anti- MRAP antibody

FNab05303 100µg
EUR 548.75
  • Immunogen: melanocortin 2 receptor accessory protein
  • Uniprot ID: Q8TCY5
  • Gene ID: 56246
  • Research Area: Neuroscience, Signal Transduction, Immunology
Description: Antibody raised against MRAP

Anti-MRAP antibody

PAab05303 100 ug
EUR 386

Anti-MRAP antibody

STJ190953 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MRAP

MRAP siRNA

20-abx924507
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MRAP siRNA

20-abx924508
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MRAP

YF-PA19984 50 ul
EUR 363
Description: Mouse polyclonal to MRAP

anti-MRAP

YF-PA19985 50 ug
EUR 363
Description: Mouse polyclonal to MRAP

MRAP Antibody, HRP conjugated

1-CSB-PA851545LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MRAP. Recognizes MRAP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MRAP Antibody, FITC conjugated

1-CSB-PA851545LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MRAP. Recognizes MRAP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MRAP Antibody, Biotin conjugated

1-CSB-PA851545LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MRAP. Recognizes MRAP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MRAP Blocking Peptide

DF9621-BP 1mg
EUR 195

MRAP cloning plasmid

CSB-CL851545HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atggccaacgggaccaacgcctctgccccatactacagctatgaatactacctggactatctggacctcattcccgtggacgagaagaagctgaaagcccacaaacattccatcgtgatcgcattctgggttagcctggctgccttcgtggtgctgctcttcctcatcttgctcta
  • Show more
Description: A cloning plasmid for the MRAP gene.

Anti-MRAP (3D12)

YF-MA18945 200 ul
EUR 363
Description: Mouse monoclonal to MRAP

Mouse MRAP shRNA Plasmid

20-abx978751
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MRAP ELISA KIT|Human

EF000881 96 Tests
EUR 689

Human MRAP shRNA Plasmid

20-abx961113
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MRAP Recombinant Protein (Human)

RP019813 100 ug Ask for price

MRAP Recombinant Protein (Rat)

RP212204 100 ug Ask for price

pDNR-LIB-MRAP Plasmid

PVT17110 2 ug
EUR 325

MRAP Recombinant Protein (Mouse)

RP151358 100 ug Ask for price

Melanocortin 2 Receptor Accessory Protein (MRAP) Antibody

20-abx113655
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 2 Receptor Accessory Protein (MRAP) Antibody

abx034603-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Melanocortin 2 Receptor Accessory Protein (MRAP) Antibody

abx034603-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Melanocortin 2 Receptor Accessory Protein (MRAP) Antibody

20-abx216924
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 2 Receptor Accessory Protein (MRAP) Antibody

abx235303-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MRAP ORF Vector (Human) (pORF)

ORF006605 1.0 ug DNA
EUR 95

Mrap ORF Vector (Mouse) (pORF)

ORF050454 1.0 ug DNA
EUR 506

Mrap ORF Vector (Rat) (pORF)

ORF070736 1.0 ug DNA
EUR 506

MRAP sgRNA CRISPR Lentivector set (Human)

K1323001 3 x 1.0 ug
EUR 339

Mrap sgRNA CRISPR Lentivector set (Mouse)

K4438901 3 x 1.0 ug
EUR 339

Mrap sgRNA CRISPR Lentivector set (Rat)

K7415901 3 x 1.0 ug
EUR 339

MRAP sgRNA CRISPR Lentivector (Human) (Target 1)

K1323002 1.0 ug DNA
EUR 154

MRAP sgRNA CRISPR Lentivector (Human) (Target 2)

K1323003 1.0 ug DNA
EUR 154

MRAP sgRNA CRISPR Lentivector (Human) (Target 3)

K1323004 1.0 ug DNA
EUR 154

Mrap sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4438902 1.0 ug DNA
EUR 154

Mrap sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4438903 1.0 ug DNA
EUR 154

Mrap sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4438904 1.0 ug DNA
EUR 154

Mrap sgRNA CRISPR Lentivector (Rat) (Target 1)

K7415902 1.0 ug DNA
EUR 154

Mrap sgRNA CRISPR Lentivector (Rat) (Target 2)

K7415903 1.0 ug DNA
EUR 154

Mrap sgRNA CRISPR Lentivector (Rat) (Target 3)

K7415904 1.0 ug DNA
EUR 154

MRAP Protein Vector (Rat) (pPB-C-His)

PV282942 500 ng
EUR 603

MRAP Protein Vector (Rat) (pPB-N-His)

PV282943 500 ng
EUR 603

MRAP Protein Vector (Rat) (pPM-C-HA)

PV282944 500 ng
EUR 603

MRAP Protein Vector (Rat) (pPM-C-His)

PV282945 500 ng
EUR 603

MRAP Protein Vector (Human) (pPB-C-His)

PV026417 500 ng
EUR 329

MRAP Protein Vector (Human) (pPB-N-His)

PV026418 500 ng
EUR 329

MRAP Protein Vector (Human) (pPM-C-HA)

PV026419 500 ng
EUR 329

MRAP Protein Vector (Human) (pPM-C-His)

PV026420 500 ng
EUR 329

MRAP Protein Vector (Mouse) (pPB-C-His)

PV201814 500 ng
EUR 603

MRAP Protein Vector (Mouse) (pPB-N-His)

PV201815 500 ng
EUR 603

MRAP Protein Vector (Mouse) (pPM-C-HA)

PV201816 500 ng
EUR 603

MRAP Protein Vector (Mouse) (pPM-C-His)

PV201817 500 ng
EUR 603

Mrap 3'UTR GFP Stable Cell Line

TU163378 1.0 ml Ask for price

Mrap 3'UTR Luciferase Stable Cell Line

TU213360 1.0 ml Ask for price

MRAP 3'UTR Luciferase Stable Cell Line

TU014502 1.0 ml
EUR 1521

Mrap 3'UTR Luciferase Stable Cell Line

TU113378 1.0 ml Ask for price

MRAP 3'UTR GFP Stable Cell Line

TU064502 1.0 ml
EUR 1521

Mrap 3'UTR GFP Stable Cell Line

TU263360 1.0 ml Ask for price

MRAP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV635701 1.0 ug DNA
EUR 514

MRAP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV635705 1.0 ug DNA
EUR 514

MRAP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV635706 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MRAP Rabbit Polyclonal Antibody