MOG Rabbit Polyclonal Antibody

MOG Rabbit Polyclonal Antibody

 

MOG Polyclonal Antibody

ABP59304-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Hu-48T 48T
EUR 479
  • Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Hu-96T 96T
EUR 621
  • Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-48T 48T
EUR 508
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-96T 96T
EUR 661
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-48Tests 48 Tests
EUR 478

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-96Tests 96 Tests
EUR 662

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-48Tests 48 Tests
EUR 511

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-96Tests 96 Tests
EUR 709

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-48Tests 48 Tests
EUR 500

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-96Tests 96 Tests
EUR 692

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-48Tests 48 Tests
EUR 534

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-96Tests 96 Tests
EUR 742

MOG Rabbit pAb

A5353-100ul 100 ul
EUR 308

MOG Rabbit pAb

A5353-200ul 200 ul
EUR 459

MOG Rabbit pAb

A5353-20ul 20 ul
EUR 183

MOG Rabbit pAb

A5353-50ul 50 ul
EUR 223

Polyclonal MOG Antibody (Center)

AMM06421G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (Center). This antibody is tested and proven to work in the following applications:

Mouse Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-230-MOG 1 Kit
EUR 773

Rat Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-240-MOG 1 Kit
EUR 773

Polyclonal Goat Anti-MOG Antibody

AMM05945G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MOG . This antibody is tested and proven to work in the following applications:

Polyclonal MOG Antibody (aa163-174)

AMM06420G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (aa163-174). This antibody is tested and proven to work in the following applications:

MOG Antibody

ABD7294 100 ug
EUR 438

MOG Antibody

32793-100ul 100ul
EUR 252

MOG antibody

70R-18564 50 ul
EUR 435
Description: Rabbit polyclonal MOG antibody

MOG Antibody

DF7294 200ul
EUR 304
Description: MOG Antibody detects endogenous levels of total MOG.

MOG Antibody

1-CSB-PA619083ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MOG Antibody

1-CSB-PA014709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MOG

GT15141 100 ug
EUR 526

Rabbit Anti-MOG ELISA Kit

ERTA0478 96Tests
EUR 521

MOG Conjugated Antibody

C32793 100ul
EUR 397

anti- MOG antibody

FNab05267 100µg
EUR 505.25
  • Immunogen: myelin oligodendrocyte glycoprotein
  • Uniprot ID: Q16653
  • Gene ID: 4340
  • Research Area: Neuroscience, Stem Cells, Immunology
Description: Antibody raised against MOG

Anti-MOG antibody

PAab05267 100 ug
EUR 355

Anti-MOG antibody

STJ70668 100 µg
EUR 359

Anti-MOG antibody

STJ27306 100 µl
EUR 277
Description: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-MOG antibody

STJ190996 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOG

MOG/ Rat MOG ELISA Kit

ELA-E0421r 96 Tests
EUR 886

MOG siRNA

20-abx924385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOG siRNA

20-abx924386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat)

4-PAA421Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat)

4-PAA421Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG)

Rabbit Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

abx363767-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

MOG (35-55)

A8306-1 1 mg
EUR 163
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG (35-55)

A8306-5 5 mg
EUR 390
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG Blocking Peptide

DF7294-BP 1mg
EUR 195

MOG cloning plasmid

CSB-CL619083HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggcaagcttatcgagaccctctctgcccagctgcctctgctccttcctcctcctcctcctcctccaagtgtcttccagctatgcagggcagttcagagtgataggaccaagacaccctatccgggctctggtcggggatgaagtggaattgccatgtcgcatatctcctgggaa
  • Show more
Description: A cloning plasmid for the MOG gene.

pBluescriptR-MOG Plasmid

PVT17024 2 ug
EUR 325

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx113907
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx137143
  • EUR 467.00
  • EUR 648.00
  • 0.5 mg
  • 1 mg
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103636
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103637
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103638
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103639
  • EUR 467.00
  • EUR 133.00
  • EUR 1372.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx104849
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx004094
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx030041-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx030041-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx173648
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx173649
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx320586
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx432979-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

abx235267-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine)

4-PAA421Bo01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC

4-PAA421Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAA421Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAA421Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), FITC

4-PAA421Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), HRP

4-PAA421Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), PE

4-PAA421Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC

4-PAA421Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAA421Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAA421Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), FITC

4-PAA421Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), HRP

4-PAA421Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), PE

4-PAA421Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), APC

4-PAA421Bo01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), Biotinylated

4-PAA421Bo01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), Cy3

4-PAA421Bo01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), FITC

4-PAA421Bo01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), HRP

4-PAA421Bo01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), PE

4-PAA421Bo01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig)

4-PAA421Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAA421Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAA421Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)

20-abx273446
  • EUR 537.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 759.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (FITC)

20-abx273804
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (FITC)

20-abx274009
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (FITC)

20-abx274141
  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody Pair

20-abx370649
  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)

20-abx271819
  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)

20-abx272612
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)

20-abx273103
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-Myelin oligodendrocyte glycoprotein/MOG Antibody

A03294 100ug/vial
EUR 334

Human MOG ELISA Kit

ELA-E0421h 96 Tests
EUR 824

MOG ELISA KIT|Human

EF000609 96 Tests
EUR 689

Human MOG shRNA Plasmid

20-abx952949
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MOG shRNA Plasmid

20-abx971548
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOG Recombinant Protein (Human)

RP019705 100 ug Ask for price

MOG Recombinant Protein (Rat)

RP212048 100 ug Ask for price

MOG Recombinant Protein (Mouse)

RP151097 100 ug Ask for price

Rabbit Anti-Myelin Oligodendrcyte protein (MOG35-55) Ig's ELISA Kit, 96 tests, Quantitative

600-210-MOG 1 Kit
EUR 834

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), APC-Cy7

4-PAA421Bo01-APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC

4-PAA421Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated

4-PAA421Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3

4-PAA421Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC

4-PAA421Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP

4-PAA421Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE

4-PAA421Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human)

4-MAA421Hu22
  • EUR 241.00
  • EUR 2417.00
  • EUR 604.00
  • EUR 301.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG)

Human Anti-MOG ELISA Kit

EHA0478 96Tests
EUR 521

Goat Anti-MOG ELISA Kit

EGTA0478 96Tests
EUR 521

Canine Anti-MOG ELISA Kit

ECA0478 96Tests
EUR 521

Chicken Anti-MOG ELISA Kit

ECKA0478 96Tests
EUR 521

Bovine Anti-MOG ELISA Kit

EBA0478 96Tests
EUR 521

Anserini Anti-MOG ELISA Kit

EAA0478 96Tests
EUR 521

Human Anti- MOG ELISA kit

ELA-E9412h 96 Tests
EUR 824

Rat Anti-MOG ELISA Kit

ERA0478 96Tests
EUR 521

Sheep Anti-MOG ELISA Kit

ESA0478 96Tests
EUR 521

Porcine Anti-MOG ELISA Kit

EPA0478 96Tests
EUR 521

Monkey Anti-MOG ELISA Kit

EMKA0478 96Tests
EUR 521

Mouse Anti-MOG ELISA Kit

EMA0478 96Tests
EUR 521

Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx260391
  • EUR 230.00
  • EUR 1970.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

MOG ORF Vector (Human) (pORF)

ORF006569 1.0 ug DNA
EUR 95

Mog ORF Vector (Mouse) (pORF)

ORF050367 1.0 ug DNA
EUR 506

Mog ORF Vector (Rat) (pORF)

ORF070684 1.0 ug DNA
EUR 506

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Bo01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55803
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0KDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16653
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.5kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Mu01
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)

4-RPA421Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q63345
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC-Cy7

4-PAA421Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly30~Tyr149)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), APC

4-MAA421Hu22-APC
  • EUR 336.00
  • EUR 3149.00
  • EUR 881.00
  • EUR 427.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), Biotinylated

4-MAA421Hu22-Biotin
  • EUR 305.00
  • EUR 2367.00
  • EUR 704.00
  • EUR 371.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), Cy3

4-MAA421Hu22-Cy3
  • EUR 407.00
  • EUR 4157.00
  • EUR 1133.00
  • EUR 528.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), FITC

4-MAA421Hu22-FITC
  • EUR 289.00
  • EUR 2539.00
  • EUR 724.00
  • EUR 361.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), HRP

4-MAA421Hu22-HRP
  • EUR 308.00
  • EUR 2745.00
  • EUR 780.00
  • EUR 387.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), PE

4-MAA421Hu22-PE
  • EUR 289.00
  • EUR 2539.00
  • EUR 724.00
  • EUR 361.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG

C051-10ug 10ug
EUR 121
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG

C051-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG

C051-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG

C051-50ug 50ug
EUR 263
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Guinea Pig Anti-MOG ELISA Kit

EGA0478 96Tests
EUR 521

Human Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx068122
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx068123
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx068124
  • EUR 481.00
  • EUR 230.00
  • EUR 1330.00
  • EUR 551.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cow Myelin Oligodendrocyte Glycoprotein (MOG) Protein

20-abx168019
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

MOG sgRNA CRISPR Lentivector set (Human)

K1316001 3 x 1.0 ug
EUR 339

Mog sgRNA CRISPR Lentivector set (Mouse)

K4333601 3 x 1.0 ug
EUR 339

 Human Myelin-oligodendrocyte glycoprotein (MOG)

1-CSB-EP619083HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 17.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Myelin-oligodendrocyte glycoprotein(MOG),partial expressed in E.coli

Mog sgRNA CRISPR Lentivector set (Rat)

K6864601 3 x 1.0 ug
EUR 339

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), APC-Cy7

4-MAA421Hu22-APC-Cy7
  • EUR 553.00
  • EUR 6178.00
  • EUR 1642.00
  • EUR 734.00
  • EUR 311.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly30~Tyr149
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

MOG Rabbit Polyclonal Antibody