MOG Rabbit Polyclonal Antibody

MOG Rabbit Polyclonal Antibody

 

MOG Polyclonal Antibody
ABP59304-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
DLR-MOG-Hu-48T	DL Develop	48T	EUR 479
Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
DLR-MOG-Hu-96T	DL Develop	96T	EUR 621
Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
DLR-MOG-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
DLR-MOG-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RD-MOG-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RD-MOG-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RD-MOG-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RD-MOG-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RDR-MOG-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RDR-MOG-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RDR-MOG-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
RDR-MOG-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

MOG Rabbit pAb
A5353-100ul	Abclonal	100 ul	EUR 308

MOG Rabbit pAb
A5353-200ul	Abclonal	200 ul	EUR 459

MOG Rabbit pAb
A5353-20ul	Abclonal	20 ul	EUR 183

MOG Rabbit pAb
A5353-50ul	Abclonal	50 ul	EUR 223

Polyclonal MOG Antibody (Center)
AMM06421G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (Center). This antibody is tested and proven to work in the following applications:

Mouse Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative
600-230-MOG	Alpha Diagnostics	1 Kit	EUR 773

Rat Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative
600-240-MOG	Alpha Diagnostics	1 Kit	EUR 773

Polyclonal Goat Anti-MOG Antibody
AMM05945G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MOG . This antibody is tested and proven to work in the following applications:

Polyclonal MOG Antibody (aa163-174)
AMM06420G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (aa163-174). This antibody is tested and proven to work in the following applications:

MOG Antibody
ABD7294	Lifescience Market	100 ug	EUR 438

MOG Antibody
32793-100ul	SAB	100ul	EUR 252

MOG antibody
70R-18564	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MOG antibody

MOG Antibody
DF7294	Affbiotech	200ul	EUR 304
Description: MOG Antibody detects endogenous levels of total MOG.

MOG Antibody
1-CSB-PA619083ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MOG Antibody
1-CSB-PA014709GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MOG
GT15141	Neuromics	100 ug	EUR 526

Rabbit Anti-MOG ELISA Kit
ERTA0478	Abclonal	96Tests	EUR 521

MOG Conjugated Antibody
C32793	SAB	100ul	EUR 397

anti- MOG antibody
FNab05267	FN Test	100µg	EUR 505.25
Immunogen: myelin oligodendrocyte glycoprotein Uniprot ID: Q16653 Gene ID: 4340 Research Area: Neuroscience, Stem Cells, Immunology
Description: Antibody raised against MOG

Anti-MOG antibody
PAab05267	Lifescience Market	100 ug	EUR 355

Anti-MOG antibody
STJ70668	St John's Laboratory	100 µg	EUR 359

Anti-MOG antibody
STJ27306	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-MOG antibody
STJ190996	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MOG

MOG/ Rat MOG ELISA Kit
ELA-E0421r	Lifescience Market	96 Tests	EUR 886

MOG siRNA
20-abx924385	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MOG siRNA
20-abx924386	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat)
4-PAA421Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat)
4-PAA421Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG)

Rabbit Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit
abx363767-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx113907	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx137143	Abbexa	EUR 467.00 EUR 648.00	0.5 mg 1 mg
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx103636	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx103637	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx103638	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx103639	Abbexa	EUR 467.00 EUR 133.00 EUR 1372.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx104849	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx004094	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
abx030041-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
abx030041-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx173648	Abbexa	EUR 314.00 EUR 787.00 EUR 411.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx173649	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
20-abx320586	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
abx432979-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody
abx235267-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

MOG (35-55)
A8306-1	ApexBio	1 mg	EUR 163
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG (35-55)
A8306-5	ApexBio	5 mg	EUR 390
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG Blocking Peptide
DF7294-BP	Affbiotech	1mg	EUR 195

MOG cloning plasmid
CSB-CL619083HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 888 Sequence: atggcaagcttatcgagaccctctctgcccagctgcctctgctccttcctcctcctcctcctcctccaagtgtcttccagctatgcagggcagttcagagtgataggaccaagacaccctatccgggctctggtcggggatgaagtggaattgccatgtcgcatatctcctgggaa Show more
Description: A cloning plasmid for the MOG gene.

pBluescriptR-MOG Plasmid
PVT17024	Lifescience Market	2 ug	EUR 325

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine)
4-PAA421Bo01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC
4-PAA421Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAA421Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAA421Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), FITC
4-PAA421Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), HRP
4-PAA421Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), PE
4-PAA421Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC
4-PAA421Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAA421Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAA421Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), FITC
4-PAA421Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), HRP
4-PAA421Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), PE
4-PAA421Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), APC
4-PAA421Bo01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), Biotinylated
4-PAA421Bo01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), Cy3
4-PAA421Bo01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), FITC
4-PAA421Bo01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), HRP
4-PAA421Bo01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), PE
4-PAA421Bo01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAA421Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAA421Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAA421Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly28~Gly152) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)
20-abx273446	Abbexa	EUR 537.00 EUR 258.00 EUR 1636.00 EUR 759.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (FITC)
20-abx273804	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (FITC)
20-abx274009	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (FITC)
20-abx274141	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody Pair
20-abx370649	Abbexa	EUR 1595.00 EUR 1024.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)
20-abx271819	Abbexa	EUR 425.00 EUR 230.00 EUR 1191.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)
20-abx272612	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody (Biotin)
20-abx273103	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-Myelin oligodendrocyte glycoprotein/MOG Antibody
A03294	BosterBio	100ug/vial	EUR 334

Human MOG ELISA Kit
ELA-E0421h	Lifescience Market	96 Tests	EUR 824

MOG ELISA KIT|Human
EF000609	Lifescience Market	96 Tests	EUR 689

Human MOG shRNA Plasmid
20-abx952949	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MOG shRNA Plasmid
20-abx971548	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MOG Recombinant Protein (Human)
RP019705	ABM	100 ug	Ask for price

MOG Recombinant Protein (Rat)
RP212048	ABM	100 ug	Ask for price

MOG Recombinant Protein (Mouse)
RP151097	ABM	100 ug	Ask for price

Rabbit Anti-Myelin Oligodendrcyte protein (MOG35-55) Ig's ELISA Kit, 96 tests, Quantitative
600-210-MOG	Alpha Diagnostics	1 Kit	EUR 834

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat, Bovine), APC-Cy7
4-PAA421Bo01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly29~Gly153) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAA421Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAA421Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAA421Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAA421Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAA421Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAA421Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human)
4-MAA421Hu22	Cloud-Clone	EUR 241.00 EUR 2417.00 EUR 604.00 EUR 301.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG)

Human Anti-MOG ELISA Kit
EHA0478	Abclonal	96Tests	EUR 521

Goat Anti-MOG ELISA Kit
EGTA0478	Abclonal	96Tests	EUR 521

Canine Anti-MOG ELISA Kit
ECA0478	Abclonal	96Tests	EUR 521

Chicken Anti-MOG ELISA Kit
ECKA0478	Abclonal	96Tests	EUR 521

Bovine Anti-MOG ELISA Kit
EBA0478	Abclonal	96Tests	EUR 521

Anserini Anti-MOG ELISA Kit
EAA0478	Abclonal	96Tests	EUR 521

Human Anti- MOG ELISA kit
ELA-E9412h	Lifescience Market	96 Tests	EUR 824

Rat Anti-MOG ELISA Kit
ERA0478	Abclonal	96Tests	EUR 521

Sheep Anti-MOG ELISA Kit
ESA0478	Abclonal	96Tests	EUR 521

Porcine Anti-MOG ELISA Kit
EPA0478	Abclonal	96Tests	EUR 521

Monkey Anti-MOG ELISA Kit
EMKA0478	Abclonal	96Tests	EUR 521

Mouse Anti-MOG ELISA Kit
EMA0478	Abclonal	96Tests	EUR 521

Myelin Oligodendrocyte Glycoprotein (MOG) Protein
20-abx260391	Abbexa	EUR 230.00 EUR 1970.00 EUR 328.00	10 ug 1 mg 50 ug
Shipped within 5-10 working days.

MOG ORF Vector (Human) (pORF)
ORF006569	ABM	1.0 ug DNA	EUR 95

Mog ORF Vector (Mouse) (pORF)
ORF050367	ABM	1.0 ug DNA	EUR 506

Mog ORF Vector (Rat) (pORF)
ORF070684	ABM	1.0 ug DNA	EUR 506

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)
4-RPA421Bo01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P55803 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.0KDa Isoelectric Point: Inquire
Description: Recombinant Bovine Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)
4-RPA421Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16653 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.5kDa Isoelectric Point: 5.9
Description: Recombinant Human Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)
4-RPA421Mu01	Cloud-Clone	EUR 332.96 EUR 192.00 EUR 973.60 EUR 391.20 EUR 682.40 EUR 286.00 EUR 2284.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61885 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

Recombinant Myelin Oligodendrocyte Glycoprotein (MOG)
4-RPA421Ra01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q63345 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.7kDa Isoelectric Point: Inquire
Description: Recombinant Rat Myelin Oligodendrocyte Glycoprotein expressed in: E.coli

MOG ELISA Kit (Rat) (OKCD00239)
OKCD00239	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Mediates homophilic cell-cell adhesion (By similarity). Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

MOG ELISA Kit (Human) (OKAN05640)
OKAN05640	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

MOG ELISA Kit (Human) (OKCD06330)
OKCD06330	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: MOG is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. MOG is involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified Minor component of the myelin sheath is involved in completion and/or maintenance of the myelin sheath and in cell- cell communication.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

MOG ELISA Kit (Mouse) (OKCA02412)
OKCA02412	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL

MOG ELISA Kit (Mouse) (OKEH05829)
OKEH05829	Aviva Systems Biology	96 Wells	EUR 766
Description: Description of target: Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication. Mediates homophilic cell-cell adhesion.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC-Cy7
4-PAA421Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MOG (Gly30~Tyr149) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), APC
4-MAA421Hu22-APC	Cloud-Clone	EUR 336.00 EUR 3149.00 EUR 881.00 EUR 427.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), Biotinylated
4-MAA421Hu22-Biotin	Cloud-Clone	EUR 305.00 EUR 2367.00 EUR 704.00 EUR 371.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Biotin.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), Cy3
4-MAA421Hu22-Cy3	Cloud-Clone	EUR 407.00 EUR 4157.00 EUR 1133.00 EUR 528.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with Cy3.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), FITC
4-MAA421Hu22-FITC	Cloud-Clone	EUR 289.00 EUR 2539.00 EUR 724.00 EUR 361.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with FITC.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), HRP
4-MAA421Hu22-HRP	Cloud-Clone	EUR 308.00 EUR 2745.00 EUR 780.00 EUR 387.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with HRP.

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), PE
4-MAA421Hu22-PE	Cloud-Clone	EUR 289.00 EUR 2539.00 EUR 724.00 EUR 361.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with PE.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG
C051-10ug	Novoprotein	10ug	EUR 121
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG
C051-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG
C051-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Recombinant Human Myelin Oligodendrocyte Glycoprotein/MOG
C051-50ug	Novoprotein	50ug	EUR 263
Description: Lyophilized from a 0.2 μm filtered solution of 20mM HAc-NaAc, 150mM NaCl, pH 4.5.

Guinea Pig Anti-MOG ELISA Kit
EGA0478	Abclonal	96Tests	EUR 521

Human Myelin Oligodendrocyte Glycoprotein (MOG) Protein
20-abx068122	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) Protein
20-abx068123	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Myelin Oligodendrocyte Glycoprotein (MOG) Protein
20-abx068124	Abbexa	EUR 481.00 EUR 230.00 EUR 1330.00 EUR 551.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Cow Myelin Oligodendrocyte Glycoprotein (MOG) Protein
20-abx168019	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

MOG sgRNA CRISPR Lentivector set (Human)
K1316001	ABM	3 x 1.0 ug	EUR 339

Mog sgRNA CRISPR Lentivector set (Mouse)
K4333601	ABM	3 x 1.0 ug	EUR 339

 Human Myelin-oligodendrocyte glycoprotein (MOG)
1-CSB-EP619083HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 17.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Myelin-oligodendrocyte glycoprotein(MOG),partial expressed in E.coli

Mog sgRNA CRISPR Lentivector set (Rat)
K6864601	ABM	3 x 1.0 ug	EUR 339

Myelin Oligodendrocyte Glycoprotein (MOG) Monoclonal Antibody (Human), APC-Cy7
4-MAA421Hu22-APC-Cy7	Cloud-Clone	EUR 553.00 EUR 6178.00 EUR 1642.00 EUR 734.00 EUR 311.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly30~Tyr149 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Myelin Oligodendrocyte Glycoprotein (MOG). This antibody is labeled with APC-Cy7.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

MOG Rabbit Polyclonal Antibody