MOBP Rabbit Polyclonal Antibody

MOBP Rabbit Polyclonal Antibody

 

MOBP Polyclonal Antibody

ABP59303-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110

MOBP Polyclonal Antibody

A69599 100 ?g
EUR 628.55
Description: Ask the seller for details

MOBP Polyclonal Antibody

30023-100ul 100ul
EUR 252

MOBP Polyclonal Antibody

30023-50ul 50ul
EUR 187

MOBP Rabbit pAb

A3964-100ul 100 ul
EUR 308

MOBP Rabbit pAb

A3964-200ul 200 ul
EUR 459

MOBP Rabbit pAb

A3964-20ul 20 ul Ask for price

MOBP Rabbit pAb

A3964-50ul 50 ul Ask for price

MOBP Rabbit pAb

A17355-100ul 100 ul
EUR 308

MOBP Rabbit pAb

A17355-200ul 200 ul
EUR 459

MOBP Rabbit pAb

A17355-20ul 20 ul
EUR 183

MOBP Rabbit pAb

A17355-50ul 50 ul
EUR 223

MOBP Polyclonal Conjugated Antibody

C30023 100ul
EUR 397

MOBP antibody

70R-18561 50 ul
EUR 435
Description: Rabbit polyclonal MOBP antibody

MOBP Antibody

DF13155 200ul
EUR 304
Description: MOBP Antibody detects endogenous levels of MOBP.

MOBP Antibody

1-CSB-PA014701GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MOBP Antibody

1-CSB-PA014701LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

Polyclonal MOBP Antibody (N-term)

AMM06418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOBP (N-term). This antibody is tested and proven to work in the following applications:

MOBP Polyclonal Antibody, HRP Conjugated

A69600 100 ?g
EUR 628.55
Description: The best epigenetics products

MOBP Polyclonal Antibody, FITC Conjugated

A69601 100 ?g
EUR 628.55
Description: kits suitable for this type of research

MOBP Polyclonal Antibody, Biotin Conjugated

A69602 100 ?g
EUR 628.55
Description: fast delivery possible

anti- MOBP antibody

FNab05262 100µg
EUR 548.75
  • Immunogen: myelin-associated oligodendrocyte basic protein
  • Uniprot ID: Q13875
  • Gene ID: 4336
  • Research Area: Developmental biology
Description: Antibody raised against MOBP

Anti-MOBP antibody

PAab05262 100 ug
EUR 386

Anti-MOBP antibody

STJ24597 100 µl
EUR 277

Anti-MOBP antibody

STJ119481 100 µl
EUR 277

Anti-MOBP antibody

STJ190995 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOBP

Mobp/ Rat Mobp ELISA Kit

ELI-15774r 96 Tests
EUR 886

MOBP siRNA

20-abx903300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOBP siRNA

20-abx924370
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOBP siRNA

20-abx924371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOBP Antibody, HRP conjugated

1-CSB-PA014701LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MOBP Antibody, FITC conjugated

1-CSB-PA014701LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MOBP Antibody, Biotin conjugated

1-CSB-PA014701LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MOBP cloning plasmid

CSB-CL014701HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 246
  • Sequence: atgagtcagaaaccggccaaggagggtcccagactctccaaaaaccagaagtactccgaacacttcagcatacactgctgcccgccgttcaccttcctcaattccaagaaggagatagtggatcggaaatacagcatctgtaagagcggctgcttctaccagaagaaagaggagga
  • Show more
Description: A cloning plasmid for the MOBP gene.

MOBP Blocking Peptide

DF13155-BP 1mg
EUR 195

pBluescriptR-MOBP Plasmid

PVT14767 2 ug
EUR 325

Anti-MOBP (1H3)

YF-MA14268 200 ul
EUR 363
Description: Mouse monoclonal to MOBP

Anti-MOBP (2F5)

YF-MA14269 200 ul
EUR 363
Description: Mouse monoclonal to MOBP

Anti-MOBP (4C2)

YF-MA14270 100 ug
EUR 363
Description: Mouse monoclonal to MOBP

Rat MOBP shRNA Plasmid

20-abx984752
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Mobp ELISA KIT

ELI-15773m 96 Tests
EUR 865

MOBP ELISA KIT|Human

EF000844 96 Tests
EUR 689

Human MOBP ELISA KIT

ELI-38576h 96 Tests
EUR 824

Human MOBP shRNA Plasmid

20-abx952945
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MOBP shRNA Plasmid

20-abx971545
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOBP Recombinant Protein (Human)

RP019690 100 ug Ask for price

MOBP Recombinant Protein (Rat)

RP212030 100 ug Ask for price

MOBP Recombinant Protein (Mouse)

RP151067 100 ug Ask for price

MOBP Recombinant Protein (Mouse)

RP151070 100 ug Ask for price

MOBP Recombinant Protein (Mouse)

RP151073 100 ug Ask for price

Myelin-Associated Oligodendrocyte Basic Protein (MOBP) Antibody

20-abx113911
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin-Associated Oligodendrocyte Basic Protein (MOBP) Antibody

20-abx002902
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Myelin-Associated Oligodendrocyte Basic Protein (MOBP) Antibody

abx033060-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myelin-Associated Oligodendrocyte Basic Protein (MOBP) Antibody

abx033060-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myelin-associated oligodendrocyte basic protein (MOBP) Antibody

20-abx338374
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myelin-Associated Oligodendrocyte Basic Protein (MOBP) Antibody

abx235262-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MOBP ORF Vector (Human) (pORF)

ORF006564 1.0 ug DNA
EUR 95

Mobp ORF Vector (Mouse) (pORF)

ORF050357 1.0 ug DNA
EUR 506

Mobp ORF Vector (Mouse) (pORF)

ORF050358 1.0 ug DNA
EUR 506

Mobp ORF Vector (Mouse) (pORF)

ORF050359 1.0 ug DNA
EUR 506

Mobp ORF Vector (Rat) (pORF)

ORF070678 1.0 ug DNA
EUR 506

Myelin-associated oligodendrocyte basic protein (MOBP) Antibody (HRP)

20-abx336622
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myelin-associated oligodendrocyte basic protein (MOBP) Antibody (FITC)

20-abx336623
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myelin-associated oligodendrocyte basic protein (MOBP) Antibody (Biotin)

20-abx336624
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MOBP sgRNA CRISPR Lentivector set (Human)

K1315201 3 x 1.0 ug
EUR 339

Mobp sgRNA CRISPR Lentivector set (Mouse)

K4509301 3 x 1.0 ug
EUR 339

Mobp sgRNA CRISPR Lentivector set (Rat)

K6830801 3 x 1.0 ug
EUR 339

MOBP sgRNA CRISPR Lentivector (Human) (Target 1)

K1315202 1.0 ug DNA
EUR 154

MOBP sgRNA CRISPR Lentivector (Human) (Target 2)

K1315203 1.0 ug DNA
EUR 154

MOBP sgRNA CRISPR Lentivector (Human) (Target 3)

K1315204 1.0 ug DNA
EUR 154

Mobp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4509302 1.0 ug DNA
EUR 154

Mobp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4509303 1.0 ug DNA
EUR 154

Mobp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4509304 1.0 ug DNA
EUR 154

Mobp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6830802 1.0 ug DNA
EUR 154

Mobp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6830803 1.0 ug DNA
EUR 154

Mobp sgRNA CRISPR Lentivector (Rat) (Target 3)

K6830804 1.0 ug DNA
EUR 154

MOBP Protein Vector (Rat) (pPB-C-His)

PV282710 500 ng
EUR 603

MOBP Protein Vector (Rat) (pPB-N-His)

PV282711 500 ng
EUR 603

MOBP Protein Vector (Rat) (pPM-C-HA)

PV282712 500 ng
EUR 603

MOBP Protein Vector (Rat) (pPM-C-His)

PV282713 500 ng
EUR 603

MOBP Protein Vector (Human) (pPB-C-His)

PV026253 500 ng
EUR 329

MOBP Protein Vector (Human) (pPB-N-His)

PV026254 500 ng
EUR 329

MOBP Protein Vector (Human) (pPM-C-HA)

PV026255 500 ng
EUR 329

MOBP Protein Vector (Human) (pPM-C-His)

PV026256 500 ng
EUR 329

MOBP Protein Vector (Mouse) (pPB-C-His)

PV201426 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPB-N-His)

PV201427 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPM-C-HA)

PV201428 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPM-C-His)

PV201429 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPB-C-His)

PV201430 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPB-N-His)

PV201431 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPM-C-HA)

PV201432 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPM-C-His)

PV201433 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPB-C-His)

PV201434 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPB-N-His)

PV201435 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPM-C-HA)

PV201436 500 ng
EUR 603

MOBP Protein Vector (Mouse) (pPM-C-His)

PV201437 500 ng
EUR 603

Mobp 3'UTR GFP Stable Cell Line

TU163311 1.0 ml Ask for price

Mobp 3'UTR Luciferase Stable Cell Line

TU213296 1.0 ml Ask for price

MOBP 3'UTR Luciferase Stable Cell Line

TU014424 1.0 ml
EUR 1521

Mobp 3'UTR Luciferase Stable Cell Line

TU113311 1.0 ml Ask for price

MOBP 3'UTR GFP Stable Cell Line

TU064424 1.0 ml
EUR 1521

Mobp 3'UTR GFP Stable Cell Line

TU263296 1.0 ml Ask for price

MOBP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV657607 1.0 ug DNA
EUR 514

MOBP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV657611 1.0 ug DNA
EUR 514

MOBP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV657612 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

MOBP Rabbit Polyclonal Antibody