MED4 Rabbit Polyclonal Antibody

MED4 Rabbit Polyclonal Antibody

 

MED4 Polyclonal Antibody

ES9793-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MED4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED4 Rabbit pAb

A14123-100ul 100 ul
EUR 308

MED4 Rabbit pAb

A14123-200ul 200 ul
EUR 459

MED4 Rabbit pAb

A14123-20ul 20 ul
EUR 183

MED4 Rabbit pAb

A14123-50ul 50 ul
EUR 223

MED4 Rabbit pAb

A9150-100ul 100 ul
EUR 308

MED4 Rabbit pAb

A9150-200ul 200 ul
EUR 459

MED4 Rabbit pAb

A9150-20ul 20 ul
EUR 183

MED4 Rabbit pAb

A9150-50ul 50 ul
EUR 223

MED4 Antibody

24727-100ul 100ul
EUR 390

MED4 antibody

70R-18469 50 ul
EUR 435
Description: Rabbit polyclonal MED4 antibody

MED4 Antibody

43340-100ul 100ul
EUR 252

MED4 Antibody

1-CSB-PA865098LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MED4 Antibody

DF9619 200ul
EUR 304
Description: MED4 Antibody detects endogenous levels of total MED4.

MED4 Antibody

1-CSB-PA219965
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED4 antibody

70R-8934 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MED4 antibody

MED4 antibody

70R-8935 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MED4 antibody

MED4 Antibody

1-CSB-PA013665GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MED4 Antibody

ABD9619 100 ug
EUR 438

MED4 antibody

PAab10105 100 ug
EUR 386

Anti-MED4 Antibody

A06467-1 100ug/vial
EUR 334

MED4 Conjugated Antibody

C43340 100ul
EUR 397

anti- MED4 antibody

FNab10105 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50 - 1:500
  • Immunogen: mediator complex subunit 4
  • Uniprot ID: Q9NPJ6
  • Gene ID: 29079
  • Research Area: Metabolism
Description: Antibody raised against MED4

anti- MED4 antibody

FNab05097 100µg
EUR 548.75
  • Immunogen: mediator complex subunit 4
  • Uniprot ID: Q9NPJ6
  • Gene ID: 29079
  • Research Area: Metabolism
Description: Antibody raised against MED4

Anti-MED4 antibody

PAab05097 100 ug
EUR 386

Anti-MED4 antibody

STJ111586 100 µl
EUR 277
Description: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-MED4 antibody

STJ116058 100 µl
EUR 277
Description: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-MED4 antibody

STJ190951 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED4

Med4/ Rat Med4 ELISA Kit

ELI-36459r 96 Tests
EUR 886

MED4 Protein

20-abx260575
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

MED4 siRNA

20-abx903210
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED4 siRNA

20-abx923873
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED4 siRNA

20-abx923874
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED4 Antibody, HRP conjugated

1-CSB-PA865098LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED4 Antibody, FITC conjugated

1-CSB-PA865098LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED4 Antibody, Biotin conjugated

1-CSB-PA865098LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MED4 Blocking Peptide

33R-2364 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED4 antibody, catalog no. 70R-8934

MED4 Blocking Peptide

33R-1435 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED4 antibody, catalog no. 70R-8935

MED4 Blocking Peptide

DF9619-BP 1mg
EUR 195

MED4 cloning plasmid

CSB-CL865098HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atggctgcgtcttcgagtggtgagaaggagaaggagcggctgggaggcggtttgggagtggcgggtggtaacagcacacgagagcggctgctgtctgcgcttgaggacttggaggtcctgtctagggaacttatagaaatgctggcaatttcaagaaaccagaagttgttacaggc
  • Show more
Description: A cloning plasmid for the MED4 gene.

Anti-MED4 (2B10)

YF-MA18238 100 ug
EUR 363
Description: Mouse monoclonal to MED4

Mediator Complex Subunit 4 (MED4) Antibody

20-abx113646
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody

20-abx123598
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody

20-abx241158
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody

abx235097-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mediator Complex Subunit 4 (MED4) Antibody

20-abx301113
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MED4 protein (His tag)

80R-1316 100 ug
EUR 268
Description: Purified recombinant Human MED4 protein

Mouse Med4 ELISA KIT

ELI-31334m 96 Tests
EUR 865

MED4 ELISA KIT|Human

EF000730 96 Tests
EUR 689

Human MED4 ELISA KIT

ELI-46079h 96 Tests
EUR 824

Rat MED4 shRNA Plasmid

20-abx989366
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MED4 shRNA Plasmid

20-abx976113
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MED4 shRNA Plasmid

20-abx959173
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine MED4 ELISA KIT

ELI-36458b 96 Tests
EUR 928

MED4 Recombinant Protein (Human)

RP019117 100 ug Ask for price

MED4 Recombinant Protein (Mouse)

RP150092 100 ug Ask for price

MED4 Recombinant Protein (Rat)

RP211316 100 ug Ask for price

Mediator Complex Subunit 4 (MED4) Antibody (HRP)

20-abx317637
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody (FITC)

20-abx317638
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody (Biotin)

20-abx317639
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Med4 ORF Vector (Rat) (pORF)

ORF070440 1.0 ug DNA
EUR 506

MED4 ORF Vector (Human) (pORF)

ORF006373 1.0 ug DNA
EUR 95

Med4 ORF Vector (Mouse) (pORF)

ORF050032 1.0 ug DNA
EUR 506

Med4 sgRNA CRISPR Lentivector set (Rat)

K6287601 3 x 1.0 ug
EUR 339

MED4 sgRNA CRISPR Lentivector set (Human)

K1284901 3 x 1.0 ug
EUR 339

Med4 sgRNA CRISPR Lentivector set (Mouse)

K3748101 3 x 1.0 ug
EUR 339

MED4-AS1 ORF Vector (Human) (pORF)

ORF023434 1.0 ug DNA Ask for price

Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit

E04M0086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit

E04M0086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit

E04M0086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Med4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6287602 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6287603 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6287604 1.0 ug DNA
EUR 154

MED4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1284902 1.0 ug DNA
EUR 154

MED4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1284903 1.0 ug DNA
EUR 154

MED4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1284904 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3748102 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3748103 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3748104 1.0 ug DNA
EUR 154

MED4 Protein Vector (Rat) (pPB-C-His)

PV281758 500 ng
EUR 603

MED4 Protein Vector (Rat) (pPB-N-His)

PV281759 500 ng
EUR 603

MED4 Protein Vector (Rat) (pPM-C-HA)

PV281760 500 ng
EUR 603

MED4 Protein Vector (Rat) (pPM-C-His)

PV281761 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPB-C-His)

PV200126 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPB-N-His)

PV200127 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPM-C-HA)

PV200128 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPM-C-His)

PV200129 500 ng
EUR 603

MED4 Protein Vector (Human) (pPB-C-His)

PV025489 500 ng
EUR 329

MED4 Protein Vector (Human) (pPB-N-His)

PV025490 500 ng
EUR 329

MED4 Protein Vector (Human) (pPM-C-HA)

PV025491 500 ng
EUR 329

MED4 Protein Vector (Human) (pPM-C-His)

PV025492 500 ng
EUR 329

Recombinant Human MED4 Protein, His, E.coli-1mg

QP12673-1mg 1mg
EUR 2312

Recombinant Human MED4 Protein, His, E.coli-25ug

QP12673-25ug 25ug
EUR 201

Recombinant Human MED4 Protein, His, E.coli-5ug

QP12673-5ug 5ug
EUR 155

Med4 3'UTR Luciferase Stable Cell Line

TU113066 1.0 ml Ask for price

Med4 3'UTR GFP Stable Cell Line

TU163066 1.0 ml Ask for price

Med4 3'UTR Luciferase Stable Cell Line

TU213037 1.0 ml Ask for price

Med4 3'UTR GFP Stable Cell Line

TU263037 1.0 ml Ask for price

MED4 3'UTR GFP Stable Cell Line

TU063171 1.0 ml
EUR 1394

MED4 3'UTR Luciferase Stable Cell Line

TU013171 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

MED4 Rabbit Polyclonal Antibody