MED4 Rabbit Polyclonal Antibody

MED4 Rabbit Polyclonal Antibody

 

MED4 Polyclonal Antibody
ABP59257-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MED4 protein at amino acid sequence of 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of MED4 from Human, Mouse, Rat. This MED4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED4 protein at amino acid sequence of 200-280

MED4 Rabbit pAb
A14123-100ul 100 ul
EUR 308

MED4 Rabbit pAb
A14123-200ul 200 ul
EUR 459

MED4 Rabbit pAb
A14123-20ul 20 ul
EUR 183

MED4 Rabbit pAb
A14123-50ul 50 ul
EUR 223

MED4 Rabbit pAb
A9150-100ul 100 ul
EUR 308

MED4 Rabbit pAb
A9150-200ul 200 ul
EUR 459

MED4 Rabbit pAb
A9150-20ul 20 ul
EUR 183

MED4 Rabbit pAb
A9150-50ul 50 ul
EUR 223

MED4 Antibody
ABD9619 100 ug
EUR 438

MED4 antibody
70R-8934 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MED4 antibody

MED4 antibody
70R-8935 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MED4 antibody

MED4 Antibody
43340-100ul 100ul
EUR 252

MED4 Antibody
24727-100ul 100ul
EUR 390

MED4 antibody
70R-18469 50 ul
EUR 435
Description: Rabbit polyclonal MED4 antibody

MED4 Antibody
DF9619 200ul
EUR 304
Description: MED4 Antibody detects endogenous levels of total MED4.

MED4 Antibody
1-CSB-PA013665GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MED4 Antibody
1-CSB-PA219965
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED4 Antibody
1-CSB-PA865098LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MED4 antibody
PAab10105 100 ug
EUR 386

MED4 Conjugated Antibody
C43340 100ul
EUR 397

anti- MED4 antibody
FNab10105 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50 - 1:500
  • Immunogen: mediator complex subunit 4
  • Uniprot ID: Q9NPJ6
  • Gene ID: 29079
  • Research Area: Metabolism
Description: Antibody raised against MED4

anti- MED4 antibody
FNab05097 100µg
EUR 548.75
  • Immunogen: mediator complex subunit 4
  • Uniprot ID: Q9NPJ6
  • Gene ID: 29079
  • Research Area: Metabolism
Description: Antibody raised against MED4

Anti-MED4 Antibody
A06467-1 100ug/vial
EUR 334

Anti-MED4 antibody
PAab05097 100 ug
EUR 386

Anti-MED4 antibody
STJ111586 100 µl
EUR 277
Description: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-MED4 antibody
STJ190951 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED4

Anti-MED4 antibody
STJ116058 100 µl
EUR 277
Description: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Med4/ Rat Med4 ELISA Kit
ELI-36459r 96 Tests
EUR 886

MED4 siRNA
20-abx903210
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED4 Protein
20-abx260575
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

MED4 siRNA
20-abx923873
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED4 siRNA
20-abx923874
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED4 Antibody, HRP conjugated
1-CSB-PA865098LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED4 Antibody, FITC conjugated
1-CSB-PA865098LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED4 Antibody, Biotin conjugated
1-CSB-PA865098LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MED4 Blocking Peptide
33R-1435 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED4 antibody, catalog no. 70R-8935

MED4 Blocking Peptide
33R-2364 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED4 antibody, catalog no. 70R-8934

MED4 cloning plasmid
CSB-CL865098HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atggctgcgtcttcgagtggtgagaaggagaaggagcggctgggaggcggtttgggagtggcgggtggtaacagcacacgagagcggctgctgtctgcgcttgaggacttggaggtcctgtctagggaacttatagaaatgctggcaatttcaagaaaccagaagttgttacaggc
  • Show more
Description: A cloning plasmid for the MED4 gene.

MED4 Blocking Peptide
DF9619-BP 1mg
EUR 195

Anti-MED4 (2B10)
YF-MA18238 100 ug
EUR 363
Description: Mouse monoclonal to MED4

Mediator Complex Subunit 4 (MED4) Antibody
20-abx123598
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody
20-abx113646
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody
20-abx241158
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody
abx235097-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mediator Complex Subunit 4 (MED4) Antibody
20-abx301113
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse MED4 shRNA Plasmid
20-abx976113
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MED4 shRNA Plasmid
20-abx989366
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MED4 ELISA KIT|Human
EF000730 96 Tests
EUR 689

Bovine MED4 ELISA KIT
ELI-36458b 96 Tests
EUR 928

Human MED4 ELISA KIT
ELI-46079h 96 Tests
EUR 824

Mouse Med4 ELISA KIT
ELI-31334m 96 Tests
EUR 865

Human MED4 shRNA Plasmid
20-abx959173
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MED4 protein (His tag)
80R-1316 100 ug
EUR 268
Description: Purified recombinant Human MED4 protein

MED4 Recombinant Protein (Human)
RP019117 100 ug Ask for price

MED4 Recombinant Protein (Rat)
RP211316 100 ug Ask for price

MED4 Recombinant Protein (Mouse)
RP150092 100 ug Ask for price

Mediator Complex Subunit 4 (MED4) Antibody (HRP)
20-abx317637
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody (FITC)
20-abx317638
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 4 (MED4) Antibody (Biotin)
20-abx317639
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MED4 ORF Vector (Human) (pORF)
ORF006373 1.0 ug DNA
EUR 95

Med4 ORF Vector (Mouse) (pORF)
ORF050032 1.0 ug DNA
EUR 506

Med4 ORF Vector (Rat) (pORF)
ORF070440 1.0 ug DNA
EUR 506

MED4 sgRNA CRISPR Lentivector set (Human)
K1284901 3 x 1.0 ug
EUR 339

Med4 sgRNA CRISPR Lentivector set (Mouse)
K3748101 3 x 1.0 ug
EUR 339

Med4 sgRNA CRISPR Lentivector set (Rat)
K6287601 3 x 1.0 ug
EUR 339

MED4-AS1 ORF Vector (Human) (pORF)
ORF023434 1.0 ug DNA Ask for price

Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit
E04M0086-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit
E04M0086-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit
E04M0086-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MED4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1284902 1.0 ug DNA
EUR 154

MED4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1284903 1.0 ug DNA
EUR 154

MED4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1284904 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3748102 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3748103 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3748104 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6287602 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6287603 1.0 ug DNA
EUR 154

Med4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6287604 1.0 ug DNA
EUR 154

Recombinant Human MED4 Protein, His, E.coli-1mg
QP12673-1mg 1mg
EUR 2312

Recombinant Human MED4 Protein, His, E.coli-25ug
QP12673-25ug 25ug
EUR 201

Recombinant Human MED4 Protein, His, E.coli-5ug
QP12673-5ug 5ug
EUR 155

MED4 Protein Vector (Rat) (pPB-C-His)
PV281758 500 ng
EUR 603

MED4 Protein Vector (Rat) (pPB-N-His)
PV281759 500 ng
EUR 603

MED4 Protein Vector (Rat) (pPM-C-HA)
PV281760 500 ng
EUR 603

MED4 Protein Vector (Rat) (pPM-C-His)
PV281761 500 ng
EUR 603

MED4 Protein Vector (Human) (pPB-C-His)
PV025489 500 ng
EUR 329

MED4 Protein Vector (Human) (pPB-N-His)
PV025490 500 ng
EUR 329

MED4 Protein Vector (Human) (pPM-C-HA)
PV025491 500 ng
EUR 329

MED4 Protein Vector (Human) (pPM-C-His)
PV025492 500 ng
EUR 329

MED4 Protein Vector (Mouse) (pPB-C-His)
PV200126 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPB-N-His)
PV200127 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPM-C-HA)
PV200128 500 ng
EUR 603

MED4 Protein Vector (Mouse) (pPM-C-His)
PV200129 500 ng
EUR 603

Med4 3'UTR GFP Stable Cell Line
TU163066 1.0 ml Ask for price

Med4 3'UTR Luciferase Stable Cell Line
TU213037 1.0 ml Ask for price

MED4 3'UTR Luciferase Stable Cell Line
TU013171 1.0 ml
EUR 1394

Med4 3'UTR Luciferase Stable Cell Line
TU113066 1.0 ml Ask for price

MED4 3'UTR GFP Stable Cell Line
TU063171 1.0 ml
EUR 1394

Med4 3'UTR GFP Stable Cell Line
TU263037 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MED4 Rabbit Polyclonal Antibody