MED4 Rabbit Polyclonal Antibody
MED4 Polyclonal Antibody |
ES9793-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MED4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MED4 Rabbit pAb |
A14123-100ul |
Abclonal |
100 ul |
EUR 308 |
MED4 Rabbit pAb |
A14123-200ul |
Abclonal |
200 ul |
EUR 459 |
MED4 Rabbit pAb |
A14123-20ul |
Abclonal |
20 ul |
EUR 183 |
MED4 Rabbit pAb |
A14123-50ul |
Abclonal |
50 ul |
EUR 223 |
MED4 Rabbit pAb |
A9150-100ul |
Abclonal |
100 ul |
EUR 308 |
MED4 Rabbit pAb |
A9150-200ul |
Abclonal |
200 ul |
EUR 459 |
MED4 Rabbit pAb |
A9150-20ul |
Abclonal |
20 ul |
EUR 183 |
MED4 Rabbit pAb |
A9150-50ul |
Abclonal |
50 ul |
EUR 223 |
MED4 Antibody |
24727-100ul |
SAB |
100ul |
EUR 390 |
MED4 antibody |
70R-18469 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MED4 antibody |
MED4 Antibody |
43340-100ul |
SAB |
100ul |
EUR 252 |
MED4 Antibody |
1-CSB-PA865098LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
MED4 Antibody |
DF9619 |
Affbiotech |
200ul |
EUR 304 |
Description: MED4 Antibody detects endogenous levels of total MED4. |
MED4 Antibody |
1-CSB-PA219965 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
MED4 antibody |
70R-8934 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MED4 antibody |
MED4 antibody |
70R-8935 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MED4 antibody |
MED4 Antibody |
1-CSB-PA013665GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Anti-MED4 Antibody |
A06467-1 |
BosterBio |
100ug/vial |
EUR 334 |
MED4 Conjugated Antibody |
C43340 |
SAB |
100ul |
EUR 397 |
anti- MED4 antibody |
FNab10105 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: IHC: 1:50 - 1:500
- Immunogen: mediator complex subunit 4
- Uniprot ID: Q9NPJ6
- Gene ID: 29079
- Research Area: Metabolism
|
Description: Antibody raised against MED4 |
anti- MED4 antibody |
FNab05097 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: mediator complex subunit 4
- Uniprot ID: Q9NPJ6
- Gene ID: 29079
- Research Area: Metabolism
|
Description: Antibody raised against MED4 |
Anti-MED4 antibody |
STJ111586 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-MED4 antibody |
STJ116058 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-MED4 antibody |
STJ190951 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MED4 |
MED4 Protein |
20-abx260575 |
Abbexa |
-
EUR 2861.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
MED4 siRNA |
20-abx903210 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED4 siRNA |
20-abx923873 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED4 siRNA |
20-abx923874 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED4 Antibody, HRP conjugated |
1-CSB-PA865098LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MED4 Antibody, FITC conjugated |
1-CSB-PA865098LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MED4 Antibody, Biotin conjugated |
1-CSB-PA865098LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED4. Recognizes MED4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MED4 Blocking Peptide |
33R-2364 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED4 antibody, catalog no. 70R-8934 |
MED4 Blocking Peptide |
33R-1435 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MED4 antibody, catalog no. 70R-8935 |
MED4 Blocking Peptide |
DF9619-BP |
Affbiotech |
1mg |
EUR 195 |
MED4 cloning plasmid |
CSB-CL865098HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 813
- Sequence: atggctgcgtcttcgagtggtgagaaggagaaggagcggctgggaggcggtttgggagtggcgggtggtaacagcacacgagagcggctgctgtctgcgcttgaggacttggaggtcctgtctagggaacttatagaaatgctggcaatttcaagaaaccagaagttgttacaggc
- Show more
|
Description: A cloning plasmid for the MED4 gene. |
Anti-MED4 (2B10) |
YF-MA18238 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MED4 |
Mediator Complex Subunit 4 (MED4) Antibody |
20-abx113646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 4 (MED4) Antibody |
20-abx123598 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 4 (MED4) Antibody |
20-abx241158 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 4 (MED4) Antibody |
abx235097-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Mediator Complex Subunit 4 (MED4) Antibody |
20-abx301113 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MED4 protein (His tag) |
80R-1316 |
Fitzgerald |
100 ug |
EUR 268 |
Description: Purified recombinant Human MED4 protein |
Rat MED4 shRNA Plasmid |
20-abx989366 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MED4 shRNA Plasmid |
20-abx976113 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MED4 shRNA Plasmid |
20-abx959173 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MED4 Recombinant Protein (Human) |
RP019117 |
ABM |
100 ug |
Ask for price |
MED4 Recombinant Protein (Mouse) |
RP150092 |
ABM |
100 ug |
Ask for price |
MED4 Recombinant Protein (Rat) |
RP211316 |
ABM |
100 ug |
Ask for price |
Mediator Complex Subunit 4 (MED4) Antibody (HRP) |
20-abx317637 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 4 (MED4) Antibody (FITC) |
20-abx317638 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 4 (MED4) Antibody (Biotin) |
20-abx317639 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Med4 ORF Vector (Rat) (pORF) |
ORF070440 |
ABM |
1.0 ug DNA |
EUR 506 |
MED4 ORF Vector (Human) (pORF) |
ORF006373 |
ABM |
1.0 ug DNA |
EUR 95 |
Med4 ORF Vector (Mouse) (pORF) |
ORF050032 |
ABM |
1.0 ug DNA |
EUR 506 |
Med4 sgRNA CRISPR Lentivector set (Rat) |
K6287601 |
ABM |
3 x 1.0 ug |
EUR 339 |
MED4 sgRNA CRISPR Lentivector set (Human) |
K1284901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Med4 sgRNA CRISPR Lentivector set (Mouse) |
K3748101 |
ABM |
3 x 1.0 ug |
EUR 339 |
MED4-AS1 ORF Vector (Human) (pORF) |
ORF023434 |
ABM |
1.0 ug DNA |
Ask for price |
Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit |
E04M0086-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit |
E04M0086-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) ELISA kit |
E04M0086-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 4(MED4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Med4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6287602 |
ABM |
1.0 ug DNA |
EUR 154 |
Med4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6287603 |
ABM |
1.0 ug DNA |
EUR 154 |
Med4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6287604 |
ABM |
1.0 ug DNA |
EUR 154 |
MED4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1284902 |
ABM |
1.0 ug DNA |
EUR 154 |
MED4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1284903 |
ABM |
1.0 ug DNA |
EUR 154 |
MED4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1284904 |
ABM |
1.0 ug DNA |
EUR 154 |
Med4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3748102 |
ABM |
1.0 ug DNA |
EUR 154 |
Med4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3748103 |
ABM |
1.0 ug DNA |
EUR 154 |
Med4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3748104 |
ABM |
1.0 ug DNA |
EUR 154 |
MED4 Protein Vector (Rat) (pPB-C-His) |
PV281758 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Rat) (pPB-N-His) |
PV281759 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Rat) (pPM-C-HA) |
PV281760 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Rat) (pPM-C-His) |
PV281761 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Mouse) (pPB-C-His) |
PV200126 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Mouse) (pPB-N-His) |
PV200127 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Mouse) (pPM-C-HA) |
PV200128 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Mouse) (pPM-C-His) |
PV200129 |
ABM |
500 ng |
EUR 603 |
MED4 Protein Vector (Human) (pPB-C-His) |
PV025489 |
ABM |
500 ng |
EUR 329 |
MED4 Protein Vector (Human) (pPB-N-His) |
PV025490 |
ABM |
500 ng |
EUR 329 |
MED4 Protein Vector (Human) (pPM-C-HA) |
PV025491 |
ABM |
500 ng |
EUR 329 |
MED4 Protein Vector (Human) (pPM-C-His) |
PV025492 |
ABM |
500 ng |
EUR 329 |
Recombinant Human MED4 Protein, His, E.coli-1mg |
QP12673-1mg |
EnQuireBio |
1mg |
EUR 2312 |
Recombinant Human MED4 Protein, His, E.coli-25ug |
QP12673-25ug |
EnQuireBio |
25ug |
EUR 201 |
Recombinant Human MED4 Protein, His, E.coli-5ug |
QP12673-5ug |
EnQuireBio |
5ug |
EUR 155 |
Med4 3'UTR Luciferase Stable Cell Line |
TU113066 |
ABM |
1.0 ml |
Ask for price |
Med4 3'UTR GFP Stable Cell Line |
TU163066 |
ABM |
1.0 ml |
Ask for price |
Med4 3'UTR Luciferase Stable Cell Line |
TU213037 |
ABM |
1.0 ml |
Ask for price |
Med4 3'UTR GFP Stable Cell Line |
TU263037 |
ABM |
1.0 ml |
Ask for price |
MED4 3'UTR GFP Stable Cell Line |
TU063171 |
ABM |
1.0 ml |
EUR 1394 |
MED4 3'UTR Luciferase Stable Cell Line |
TU013171 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
MED4 Rabbit Polyclonal Antibody