MED30 Rabbit Polyclonal Antibody
 MED30 Polyclonal Antibody |
|
ABP59255-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150 |
MED30 Polyclonal Antibody |
|
ABP59255-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150 |
MED30 Polyclonal Antibody |
|
ABP59255-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150 |
MED30 Polyclonal Antibody |
|
A59782 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 MED30 Rabbit pAb |
|
A13135-100ul |
Abclonal |
100 ul |
EUR 308 |
MED30 Rabbit pAb |
|
A13135-200ul |
Abclonal |
200 ul |
EUR 459 |
MED30 Rabbit pAb |
|
A13135-20ul |
Abclonal |
20 ul |
EUR 183 |
MED30 Rabbit pAb |
|
A13135-50ul |
Abclonal |
50 ul |
EUR 223 |
 MED30 antibody |
|
70R-51149 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal MED30 antibody |
 MED30 Antibody |
|
46038-100ul |
SAB |
100ul |
EUR 252 |
MED30 Antibody |
|
46038-50ul |
SAB |
50ul |
EUR 187 |
MED30 antibody |
|
70R-18467 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal MED30 antibody |
MED30 Antibody |
|
DF9617 |
Affbiotech |
200ul |
EUR 304 |
|
Description: MED30 Antibody detects endogenous levels of total MED30. |
MED30 Antibody |
|
1-CSB-PA013663GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MED30 Antibody |
|
1-CSB-PA822225LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 MED30 Polyclonal Antibody, Biotin Conjugated |
|
A59783 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 MED30 Polyclonal Antibody, FITC Conjugated |
|
A59784 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 MED30 Polyclonal Antibody, HRP Conjugated |
|
A59785 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 MED30 Conjugated Antibody |
|
C46038 |
SAB |
100ul |
EUR 397 |
 anti- MED30 antibody |
|
FNab05095 |
FN Test |
100µg |
EUR 585 |
- Immunogen: mediator complex subunit 30
- Uniprot ID: Q96HR3
- Gene ID: 90390
- Research Area: Metabolism
|
|
Description: Antibody raised against MED30 |
 Anti-MED30 antibody |
|
STJ190949 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to MED30 |
 MED30 siRNA |
|
20-abx923869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED30 siRNA |
|
20-abx923870 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 MED30 Antibody, HRP conjugated |
|
1-CSB-PA822225LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 MED30 Antibody, FITC conjugated |
|
1-CSB-PA822225LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 MED30 Antibody, Biotin conjugated |
|
1-CSB-PA822225LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 MED30 Blocking Peptide |
|
20-abx064024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED30 Blocking Peptide |
|
DF9617-BP |
Affbiotech |
1mg |
EUR 195 |
 MED30 cloning plasmid |
|
CSB-CL822225HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atgtccacccctccgttggccgcgtcggggatggcgcccgggcccttcgccgggccccaggctcagcaggccgcccgggaagtcaacacggcgtcgctgtgccgcatcgggcaggagacagtgcaggacatcgtgtaccgcaccatggagatcttccagctcctgaggaacatgca
- Show more
|
|
Description: A cloning plasmid for the MED30 gene. |
 anti-MED30 / TRAP25 |
|
YF-PA21647 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to MED30 / TRAP25 |
anti-MED30 / TRAP25 |
|
YF-PA21648 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to MED30 / TRAP25 |
 Mouse MED30 shRNA Plasmid |
|
20-abx977056 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human MED30 shRNA Plasmid |
|
20-abx963939 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MED30 Recombinant Protein (Human) |
|
RP019111 |
ABM |
100 ug |
Ask for price |
) MED30 Recombinant Protein (Rat) |
|
RP211310 |
ABM |
100 ug |
Ask for price |
) MED30 Recombinant Protein (Mouse) |
|
RP150086 |
ABM |
100 ug |
Ask for price |
 Antibody) Mediator Complex Subunit 30 (MED30) Antibody |
|
20-abx113644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
|
20-abx007991 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
|
abx030801-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
|
abx030801-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
|
20-abx216783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
|
abx235095-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
|
20-abx301517 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Mediator Complex Subunit 30 (MED30) Antibody (HRP) |
|
20-abx308905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Mediator Complex Subunit 30 (MED30) Antibody (FITC) |
|
20-abx308906 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Mediator Complex Subunit 30 (MED30) Antibody (Biotin) |
|
20-abx308907 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) MED30 ORF Vector (Human) (pORF) |
|
ORF006371 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Med30 ORF Vector (Mouse) (pORF) |
|
ORF050030 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Med30 ORF Vector (Rat) (pORF) |
|
ORF070438 |
ABM |
1.0 ug DNA |
EUR 506 |
) MED30 sgRNA CRISPR Lentivector set (Human) |
|
K1287801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Med30 sgRNA CRISPR Lentivector set (Mouse) |
|
K3740001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Med30 sgRNA CRISPR Lentivector set (Rat) |
|
K6134601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA kit) Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit |
|
E04M0084-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit |
|
E04M0084-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit |
|
E04M0084-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 (Target 1)) MED30 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1287802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) MED30 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1287803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) MED30 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1287804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Med30 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3740002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Med30 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3740003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Med30 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3740004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Med30 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6134602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Med30 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6134603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Med30 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6134604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MED30 Protein Vector (Rat) (pPB-C-His) |
|
PV281750 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MED30 Protein Vector (Rat) (pPB-N-His) |
|
PV281751 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MED30 Protein Vector (Rat) (pPM-C-HA) |
|
PV281752 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) MED30 Protein Vector (Rat) (pPM-C-His) |
|
PV281753 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) MED30 Protein Vector (Human) (pPB-C-His) |
|
PV025481 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) MED30 Protein Vector (Human) (pPB-N-His) |
|
PV025482 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) MED30 Protein Vector (Human) (pPM-C-HA) |
|
PV025483 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) MED30 Protein Vector (Human) (pPM-C-His) |
|
PV025484 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) MED30 Protein Vector (Mouse) (pPB-C-His) |
|
PV200118 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MED30 Protein Vector (Mouse) (pPB-N-His) |
|
PV200119 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MED30 Protein Vector (Mouse) (pPM-C-HA) |
|
PV200120 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) MED30 Protein Vector (Mouse) (pPM-C-His) |
|
PV200121 |
ABM |
500 ng |
EUR 603 |
 Med30 3'UTR GFP Stable Cell Line |
|
TU163064 |
ABM |
1.0 ml |
Ask for price |
 Med30 3'UTR Luciferase Stable Cell Line |
|
TU213035 |
ABM |
1.0 ml |
Ask for price |
 MED30 3'UTR Luciferase Stable Cell Line |
|
TU013201 |
ABM |
1.0 ml |
EUR 1394 |
Med30 3'UTR Luciferase Stable Cell Line |
|
TU113064 |
ABM |
1.0 ml |
Ask for price |
 MED30 3'UTR GFP Stable Cell Line |
|
TU063201 |
ABM |
1.0 ml |
EUR 1394 |
Med30 3'UTR GFP Stable Cell Line |
|
TU263035 |
ABM |
1.0 ml |
Ask for price |
 ELISA Kit) Human Mediator Complex Subunit 30 (MED30) ELISA Kit |
|
abx381400-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MED30 Rabbit Polyclonal Antibody
