MED30 Rabbit Polyclonal Antibody

MED30 Rabbit Polyclonal Antibody

 

MED30 Polyclonal Antibody

ABP59255-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150

MED30 Polyclonal Antibody

ABP59255-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150

MED30 Polyclonal Antibody

ABP59255-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150

MED30 Polyclonal Antibody

A59782 100 µg
EUR 570.55
Description: Ask the seller for details

MED30 Rabbit pAb

A13135-100ul 100 ul
EUR 308

MED30 Rabbit pAb

A13135-200ul 200 ul
EUR 459

MED30 Rabbit pAb

A13135-20ul 20 ul
EUR 183

MED30 Rabbit pAb

A13135-50ul 50 ul
EUR 223

MED30 Antibody

ABD9617 100 ug
EUR 438

MED30 antibody

70R-51149 100 ul
EUR 244
Description: Purified Polyclonal MED30 antibody

MED30 Antibody

46038-100ul 100ul
EUR 252

MED30 Antibody

46038-50ul 50ul
EUR 187

MED30 antibody

70R-18467 50 ul
EUR 435
Description: Rabbit polyclonal MED30 antibody

MED30 Antibody

DF9617 200ul
EUR 304
Description: MED30 Antibody detects endogenous levels of total MED30.

MED30 Antibody

1-CSB-PA013663GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MED30 Antibody

1-CSB-PA822225LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MED30 Polyclonal Antibody, Biotin Conjugated

A59783 100 µg
EUR 570.55
Description: The best epigenetics products

MED30 Polyclonal Antibody, FITC Conjugated

A59784 100 µg
EUR 570.55
Description: kits suitable for this type of research

MED30 Polyclonal Antibody, HRP Conjugated

A59785 100 µg
EUR 570.55
Description: fast delivery possible

MED30 Conjugated Antibody

C46038 100ul
EUR 397

anti- MED30 antibody

FNab05095 100µg
EUR 585
  • Immunogen: mediator complex subunit 30
  • Uniprot ID: Q96HR3
  • Gene ID: 90390
  • Research Area: Metabolism
Description: Antibody raised against MED30

Anti-MED30 antibody

PAab05095 100 ug
EUR 412

Anti-MED30 antibody

STJ115101 100 µl
EUR 277

Anti-MED30 antibody

STJ190949 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED30

MED30 siRNA

20-abx923869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED30 siRNA

20-abx923870
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED30 Antibody, HRP conjugated

1-CSB-PA822225LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED30 Antibody, FITC conjugated

1-CSB-PA822225LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED30 Antibody, Biotin conjugated

1-CSB-PA822225LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MED30 Blocking Peptide

20-abx064024
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MED30 Blocking Peptide

DF9617-BP 1mg
EUR 195

MED30 cloning plasmid

CSB-CL822225HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgtccacccctccgttggccgcgtcggggatggcgcccgggcccttcgccgggccccaggctcagcaggccgcccgggaagtcaacacggcgtcgctgtgccgcatcgggcaggagacagtgcaggacatcgtgtaccgcaccatggagatcttccagctcctgaggaacatgca
  • Show more
Description: A cloning plasmid for the MED30 gene.

pCMV-SPORT6-MED30

PVT12796 2 ug
EUR 391

anti-MED30 / TRAP25

YF-PA21647 50 ul
EUR 363
Description: Mouse polyclonal to MED30 / TRAP25

anti-MED30 / TRAP25

YF-PA21648 50 ug
EUR 363
Description: Mouse polyclonal to MED30 / TRAP25

Mouse MED30 shRNA Plasmid

20-abx977056
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MED30 shRNA Plasmid

20-abx963939
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MED30 ELISA KIT|Human

EF000729 96 Tests
EUR 689

Mouse Med30 ELISA KIT

ELI-46002m 96 Tests
EUR 865

Bovine MED30 ELISA KIT

ELI-31333b 96 Tests
EUR 928

Human MED30 ELISA KIT

ELI-48188h 96 Tests
EUR 824

MED30 Recombinant Protein (Human)

RP019111 100 ug Ask for price

MED30 Recombinant Protein (Rat)

RP211310 100 ug Ask for price

MED30 Recombinant Protein (Mouse)

RP150086 100 ug Ask for price

Mediator Complex Subunit 30 (MED30) Antibody

20-abx113644
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

20-abx007991
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

abx030801-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

abx030801-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

20-abx216783
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

abx235095-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mediator Complex Subunit 30 (MED30) Antibody

20-abx301517
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody (HRP)

20-abx308905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody (FITC)

20-abx308906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody (Biotin)

20-abx308907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MED30 ORF Vector (Human) (pORF)

ORF006371 1.0 ug DNA
EUR 95

Med30 ORF Vector (Mouse) (pORF)

ORF050030 1.0 ug DNA
EUR 506

Med30 ORF Vector (Rat) (pORF)

ORF070438 1.0 ug DNA
EUR 506

MED30 sgRNA CRISPR Lentivector set (Human)

K1287801 3 x 1.0 ug
EUR 339

Med30 sgRNA CRISPR Lentivector set (Mouse)

K3740001 3 x 1.0 ug
EUR 339

Med30 sgRNA CRISPR Lentivector set (Rat)

K6134601 3 x 1.0 ug
EUR 339

Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit

E04M0084-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit

E04M0084-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit

E04M0084-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MED30 sgRNA CRISPR Lentivector (Human) (Target 1)

K1287802 1.0 ug DNA
EUR 154

MED30 sgRNA CRISPR Lentivector (Human) (Target 2)

K1287803 1.0 ug DNA
EUR 154

MED30 sgRNA CRISPR Lentivector (Human) (Target 3)

K1287804 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3740002 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3740003 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3740004 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6134602 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6134603 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6134604 1.0 ug DNA
EUR 154

MED30 Protein Vector (Rat) (pPB-C-His)

PV281750 500 ng
EUR 603

MED30 Protein Vector (Rat) (pPB-N-His)

PV281751 500 ng
EUR 603

MED30 Protein Vector (Rat) (pPM-C-HA)

PV281752 500 ng
EUR 603

MED30 Protein Vector (Rat) (pPM-C-His)

PV281753 500 ng
EUR 603

MED30 Protein Vector (Human) (pPB-C-His)

PV025481 500 ng
EUR 329

MED30 Protein Vector (Human) (pPB-N-His)

PV025482 500 ng
EUR 329

MED30 Protein Vector (Human) (pPM-C-HA)

PV025483 500 ng
EUR 329

MED30 Protein Vector (Human) (pPM-C-His)

PV025484 500 ng
EUR 329

MED30 Protein Vector (Mouse) (pPB-C-His)

PV200118 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPB-N-His)

PV200119 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPM-C-HA)

PV200120 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPM-C-His)

PV200121 500 ng
EUR 603

Med30 3'UTR GFP Stable Cell Line

TU163064 1.0 ml Ask for price

Med30 3'UTR Luciferase Stable Cell Line

TU213035 1.0 ml Ask for price

MED30 3'UTR Luciferase Stable Cell Line

TU013201 1.0 ml
EUR 1394

Med30 3'UTR Luciferase Stable Cell Line

TU113064 1.0 ml Ask for price

MED30 3'UTR GFP Stable Cell Line

TU063201 1.0 ml
EUR 1394

Med30 3'UTR GFP Stable Cell Line

TU263035 1.0 ml Ask for price

Human Mediator Complex Subunit 30 (MED30) ELISA Kit

abx381400-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MED30 Rabbit Polyclonal Antibody