MED30 Rabbit Polyclonal Antibody

MED30 Rabbit Polyclonal Antibody

 

MED30 Polyclonal Antibody

ABP59255-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150

MED30 Polyclonal Antibody

ABP59255-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150

MED30 Polyclonal Antibody

ES9791-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MED30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED30 Polyclonal Antibody

ES9791-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MED30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED30 Rabbit pAb

A13135-100ul 100 ul
EUR 308

MED30 Rabbit pAb

A13135-200ul 200 ul
EUR 459

MED30 Rabbit pAb

A13135-20ul 20 ul
EUR 183

MED30 Rabbit pAb

A13135-50ul 50 ul
EUR 223

MED30 antibody

70R-18467 50 ul
EUR 435
Description: Rabbit polyclonal MED30 antibody

MED30 Antibody

46038-100ul 100ul
EUR 252

MED30 Antibody

46038-50ul 50ul
EUR 187

MED30 Antibody

1-CSB-PA822225LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MED30 Antibody

DF9617 200ul
EUR 304
Description: MED30 Antibody detects endogenous levels of total MED30.

MED30 antibody

70R-51149 100 ul
EUR 244
Description: Purified Polyclonal MED30 antibody

MED30 Antibody

1-CSB-PA013663GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MED30 Antibody

ABD9617 100 ug
EUR 438

MED30 Polyclonal Antibody, Biotin Conjugated

A59783 100 µg
EUR 570.55
Description: The best epigenetics products

MED30 Polyclonal Antibody, FITC Conjugated

A59784 100 µg
EUR 570.55
Description: kits suitable for this type of research

MED30 Polyclonal Antibody, HRP Conjugated

A59785 100 µg
EUR 570.55
Description: fast delivery possible

MED30 Conjugated Antibody

C46038 100ul
EUR 397

anti- MED30 antibody

FNab05095 100µg
EUR 585
  • Immunogen: mediator complex subunit 30
  • Uniprot ID: Q96HR3
  • Gene ID: 90390
  • Research Area: Metabolism
Description: Antibody raised against MED30

Anti-MED30 antibody

PAab05095 100 ug
EUR 412

Anti-MED30 antibody

STJ115101 100 µl
EUR 277

Anti-MED30 antibody

STJ190949 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED30

MED30 siRNA

20-abx923869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED30 siRNA

20-abx923870
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED30 Antibody, HRP conjugated

1-CSB-PA822225LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED30 Antibody, FITC conjugated

1-CSB-PA822225LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED30 Antibody, Biotin conjugated

1-CSB-PA822225LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MED30 Blocking Peptide

DF9617-BP 1mg
EUR 195

MED30 Blocking Peptide

20-abx064024
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MED30 cloning plasmid

CSB-CL822225HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgtccacccctccgttggccgcgtcggggatggcgcccgggcccttcgccgggccccaggctcagcaggccgcccgggaagtcaacacggcgtcgctgtgccgcatcgggcaggagacagtgcaggacatcgtgtaccgcaccatggagatcttccagctcctgaggaacatgca
  • Show more
Description: A cloning plasmid for the MED30 gene.

pCMV-SPORT6-MED30

PVT12796 2 ug
EUR 391

anti-MED30 / TRAP25

YF-PA21647 50 ul
EUR 363
Description: Mouse polyclonal to MED30 / TRAP25

anti-MED30 / TRAP25

YF-PA21648 50 ug
EUR 363
Description: Mouse polyclonal to MED30 / TRAP25

Bovine MED30 ELISA KIT

ELI-31333b 96 Tests
EUR 928

MED30 ELISA KIT|Human

EF000729 96 Tests
EUR 689

Mouse Med30 ELISA KIT

ELI-46002m 96 Tests
EUR 865

Mouse MED30 shRNA Plasmid

20-abx977056
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MED30 shRNA Plasmid

20-abx963939
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MED30 ELISA KIT

ELI-48188h 96 Tests
EUR 824

MED30 Recombinant Protein (Human)

RP019111 100 ug Ask for price

MED30 Recombinant Protein (Mouse)

RP150086 100 ug Ask for price

MED30 Recombinant Protein (Rat)

RP211310 100 ug Ask for price

Mediator Complex Subunit 30 (MED30) Antibody

20-abx007991
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

20-abx216783
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

20-abx113644
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

abx030801-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

abx030801-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody

abx235095-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mediator Complex Subunit 30 (MED30) Antibody

20-abx301517
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody (HRP)

20-abx308905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody (FITC)

20-abx308906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 30 (MED30) Antibody (Biotin)

20-abx308907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Med30 ORF Vector (Rat) (pORF)

ORF070438 1.0 ug DNA
EUR 506

MED30 ORF Vector (Human) (pORF)

ORF006371 1.0 ug DNA
EUR 95

Med30 ORF Vector (Mouse) (pORF)

ORF050030 1.0 ug DNA
EUR 506

Med30 sgRNA CRISPR Lentivector set (Rat)

K6134601 3 x 1.0 ug
EUR 339

MED30 sgRNA CRISPR Lentivector set (Human)

K1287801 3 x 1.0 ug
EUR 339

Med30 sgRNA CRISPR Lentivector set (Mouse)

K3740001 3 x 1.0 ug
EUR 339

Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit

E04M0084-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit

E04M0084-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit

E04M0084-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Med30 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6134602 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6134603 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6134604 1.0 ug DNA
EUR 154

MED30 sgRNA CRISPR Lentivector (Human) (Target 1)

K1287802 1.0 ug DNA
EUR 154

MED30 sgRNA CRISPR Lentivector (Human) (Target 2)

K1287803 1.0 ug DNA
EUR 154

MED30 sgRNA CRISPR Lentivector (Human) (Target 3)

K1287804 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3740002 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3740003 1.0 ug DNA
EUR 154

Med30 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3740004 1.0 ug DNA
EUR 154

MED30 Protein Vector (Rat) (pPB-C-His)

PV281750 500 ng
EUR 603

MED30 Protein Vector (Rat) (pPB-N-His)

PV281751 500 ng
EUR 603

MED30 Protein Vector (Rat) (pPM-C-HA)

PV281752 500 ng
EUR 603

MED30 Protein Vector (Rat) (pPM-C-His)

PV281753 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPB-C-His)

PV200118 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPB-N-His)

PV200119 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPM-C-HA)

PV200120 500 ng
EUR 603

MED30 Protein Vector (Mouse) (pPM-C-His)

PV200121 500 ng
EUR 603

MED30 Protein Vector (Human) (pPB-C-His)

PV025481 500 ng
EUR 329

MED30 Protein Vector (Human) (pPB-N-His)

PV025482 500 ng
EUR 329

MED30 Protein Vector (Human) (pPM-C-HA)

PV025483 500 ng
EUR 329

MED30 Protein Vector (Human) (pPM-C-His)

PV025484 500 ng
EUR 329

Med30 3'UTR Luciferase Stable Cell Line

TU113064 1.0 ml Ask for price

Med30 3'UTR GFP Stable Cell Line

TU163064 1.0 ml Ask for price

Med30 3'UTR Luciferase Stable Cell Line

TU213035 1.0 ml Ask for price

Med30 3'UTR GFP Stable Cell Line

TU263035 1.0 ml Ask for price

MED30 3'UTR GFP Stable Cell Line

TU063201 1.0 ml
EUR 1394

MED30 3'UTR Luciferase Stable Cell Line

TU013201 1.0 ml
EUR 1394

Human Mediator Complex Subunit 30 (MED30) ELISA Kit

abx381400-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

MED30 Rabbit Polyclonal Antibody