MED30 Rabbit Polyclonal Antibody
MED30 Polyclonal Antibody |
ABP59255-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150 |
MED30 Polyclonal Antibody |
ABP59255-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of MED30 from Human, Mouse. This MED30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED30 protein at amino acid sequence of 70-150 |
MED30 Polyclonal Antibody |
ES9791-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MED30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MED30 Polyclonal Antibody |
ES9791-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MED30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MED30 Rabbit pAb |
A13135-100ul |
Abclonal |
100 ul |
EUR 308 |
MED30 Rabbit pAb |
A13135-200ul |
Abclonal |
200 ul |
EUR 459 |
MED30 Rabbit pAb |
A13135-20ul |
Abclonal |
20 ul |
EUR 183 |
MED30 Rabbit pAb |
A13135-50ul |
Abclonal |
50 ul |
EUR 223 |
MED30 antibody |
70R-18467 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MED30 antibody |
MED30 Antibody |
46038-100ul |
SAB |
100ul |
EUR 252 |
MED30 Antibody |
46038-50ul |
SAB |
50ul |
EUR 187 |
MED30 Antibody |
1-CSB-PA822225LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
MED30 Antibody |
DF9617 |
Affbiotech |
200ul |
EUR 304 |
Description: MED30 Antibody detects endogenous levels of total MED30. |
MED30 antibody |
70R-51149 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MED30 antibody |
MED30 Antibody |
1-CSB-PA013663GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MED30 Polyclonal Antibody, Biotin Conjugated |
A59783 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
MED30 Polyclonal Antibody, FITC Conjugated |
A59784 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
MED30 Polyclonal Antibody, HRP Conjugated |
A59785 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
MED30 Conjugated Antibody |
C46038 |
SAB |
100ul |
EUR 397 |
anti- MED30 antibody |
FNab05095 |
FN Test |
100µg |
EUR 585 |
- Immunogen: mediator complex subunit 30
- Uniprot ID: Q96HR3
- Gene ID: 90390
- Research Area: Metabolism
|
Description: Antibody raised against MED30 |
Anti-MED30 antibody |
STJ190949 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MED30 |
MED30 siRNA |
20-abx923869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED30 siRNA |
20-abx923870 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED30 Antibody, HRP conjugated |
1-CSB-PA822225LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MED30 Antibody, FITC conjugated |
1-CSB-PA822225LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MED30 Antibody, Biotin conjugated |
1-CSB-PA822225LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED30. Recognizes MED30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MED30 Blocking Peptide |
DF9617-BP |
Affbiotech |
1mg |
EUR 195 |
MED30 Blocking Peptide |
20-abx064024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED30 cloning plasmid |
CSB-CL822225HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atgtccacccctccgttggccgcgtcggggatggcgcccgggcccttcgccgggccccaggctcagcaggccgcccgggaagtcaacacggcgtcgctgtgccgcatcgggcaggagacagtgcaggacatcgtgtaccgcaccatggagatcttccagctcctgaggaacatgca
- Show more
|
Description: A cloning plasmid for the MED30 gene. |
anti-MED30 / TRAP25 |
YF-PA21647 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to MED30 / TRAP25 |
anti-MED30 / TRAP25 |
YF-PA21648 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MED30 / TRAP25 |
Mouse MED30 shRNA Plasmid |
20-abx977056 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MED30 shRNA Plasmid |
20-abx963939 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MED30 Recombinant Protein (Human) |
RP019111 |
ABM |
100 ug |
Ask for price |
MED30 Recombinant Protein (Mouse) |
RP150086 |
ABM |
100 ug |
Ask for price |
MED30 Recombinant Protein (Rat) |
RP211310 |
ABM |
100 ug |
Ask for price |
Mediator Complex Subunit 30 (MED30) Antibody |
20-abx007991 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
20-abx216783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
20-abx113644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
abx030801-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
abx030801-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
abx235095-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody |
20-abx301517 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody (HRP) |
20-abx308905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody (FITC) |
20-abx308906 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 30 (MED30) Antibody (Biotin) |
20-abx308907 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Med30 ORF Vector (Rat) (pORF) |
ORF070438 |
ABM |
1.0 ug DNA |
EUR 506 |
MED30 ORF Vector (Human) (pORF) |
ORF006371 |
ABM |
1.0 ug DNA |
EUR 95 |
Med30 ORF Vector (Mouse) (pORF) |
ORF050030 |
ABM |
1.0 ug DNA |
EUR 506 |
Med30 sgRNA CRISPR Lentivector set (Rat) |
K6134601 |
ABM |
3 x 1.0 ug |
EUR 339 |
MED30 sgRNA CRISPR Lentivector set (Human) |
K1287801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Med30 sgRNA CRISPR Lentivector set (Mouse) |
K3740001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit |
E04M0084-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit |
E04M0084-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) ELISA kit |
E04M0084-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 30(MED30) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Med30 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6134602 |
ABM |
1.0 ug DNA |
EUR 154 |
Med30 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6134603 |
ABM |
1.0 ug DNA |
EUR 154 |
Med30 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6134604 |
ABM |
1.0 ug DNA |
EUR 154 |
MED30 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1287802 |
ABM |
1.0 ug DNA |
EUR 154 |
MED30 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1287803 |
ABM |
1.0 ug DNA |
EUR 154 |
MED30 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1287804 |
ABM |
1.0 ug DNA |
EUR 154 |
Med30 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3740002 |
ABM |
1.0 ug DNA |
EUR 154 |
Med30 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3740003 |
ABM |
1.0 ug DNA |
EUR 154 |
Med30 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3740004 |
ABM |
1.0 ug DNA |
EUR 154 |
MED30 Protein Vector (Rat) (pPB-C-His) |
PV281750 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Rat) (pPB-N-His) |
PV281751 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Rat) (pPM-C-HA) |
PV281752 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Rat) (pPM-C-His) |
PV281753 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Mouse) (pPB-C-His) |
PV200118 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Mouse) (pPB-N-His) |
PV200119 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Mouse) (pPM-C-HA) |
PV200120 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Mouse) (pPM-C-His) |
PV200121 |
ABM |
500 ng |
EUR 603 |
MED30 Protein Vector (Human) (pPB-C-His) |
PV025481 |
ABM |
500 ng |
EUR 329 |
MED30 Protein Vector (Human) (pPB-N-His) |
PV025482 |
ABM |
500 ng |
EUR 329 |
MED30 Protein Vector (Human) (pPM-C-HA) |
PV025483 |
ABM |
500 ng |
EUR 329 |
MED30 Protein Vector (Human) (pPM-C-His) |
PV025484 |
ABM |
500 ng |
EUR 329 |
Med30 3'UTR Luciferase Stable Cell Line |
TU113064 |
ABM |
1.0 ml |
Ask for price |
Med30 3'UTR GFP Stable Cell Line |
TU163064 |
ABM |
1.0 ml |
Ask for price |
Med30 3'UTR Luciferase Stable Cell Line |
TU213035 |
ABM |
1.0 ml |
Ask for price |
Med30 3'UTR GFP Stable Cell Line |
TU263035 |
ABM |
1.0 ml |
Ask for price |
MED30 3'UTR GFP Stable Cell Line |
TU063201 |
ABM |
1.0 ml |
EUR 1394 |
MED30 3'UTR Luciferase Stable Cell Line |
TU013201 |
ABM |
1.0 ml |
EUR 1394 |
Human Mediator Complex Subunit 30 (MED30) ELISA Kit |
abx381400-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
MED30 Rabbit Polyclonal Antibody