MED15 Rabbit Polyclonal Antibody

MED15 Rabbit Polyclonal Antibody


MED15 Polyclonal Antibody

ABP59250-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590

MED15 Polyclonal Antibody

ABP59250-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590

MED15 Polyclonal Antibody

ABP59250-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590

MED15 Polyclonal Antibody

A69091 100 ?g
EUR 628.55
Description: reagents widely cited

MED15 Rabbit pAb

A18238-100ul 100 ul
EUR 308

MED15 Rabbit pAb

A18238-200ul 200 ul
EUR 459

MED15 Rabbit pAb

A18238-20ul 20 ul
EUR 183

MED15 Rabbit pAb

A18238-50ul 50 ul
EUR 223

MED15 Antibody

ABD9613 100 ug
EUR 438

MED15 antibody

70R-50994 100 ul
EUR 244
Description: Purified Polyclonal MED15 antibody

MED15 Antibody

40263-100ul 100ul
EUR 252

MED15 antibody

70R-18461 50 ul
EUR 435
Description: Rabbit polyclonal MED15 antibody

MED15 Antibody

DF9613 200ul
EUR 304
Description: MED15 Antibody detects endogenous levels of total MED15.

MED15 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MED15 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

MED15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

MED15 Polyclonal Antibody, HRP Conjugated

A69092 100 ?g
EUR 628.55
Description: Ask the seller for details

MED15 Polyclonal Antibody, FITC Conjugated

A69093 100 ?g
EUR 628.55
Description: The best epigenetics products

MED15 Polyclonal Antibody, Biotin Conjugated

A69094 100 ?g
EUR 628.55
Description: kits suitable for this type of research

MED15 Conjugated Antibody

C40263 100ul
EUR 397

anti- MED15 antibody

FNab05089 100µg
EUR 585
  • Immunogen: mediator complex subunit 15
  • Uniprot ID: Q96RN5
  • Gene ID: 51586
  • Research Area: Metabolism
Description: Antibody raised against MED15

Anti-MED15 Antibody

A03568-1 100ug/vial
EUR 334

Anti-MED15 antibody

PAab05089 100 ug
EUR 412

Anti-MED15 antibody

STJ11100195 100 µl
EUR 277
Description: The protein encoded by this gene is a subunit of the multiprotein complexes PC2 and ARC/DRIP and may function as a transcriptional coactivator in RNA polymerase II transcription. This gene contains stretches of trinucleotide repeats and is located in the chromosome 22 region which is deleted in DiGeorge syndrome. Alternative splicing results in multiple transcript variants.

Anti-MED15 antibody

STJ190945 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED15


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED15 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED15 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED15 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-PCQAP / MED15 antibody

STJ71834 100 µg
EUR 359

MED15 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MED15 Blocking Peptide

DF9613-BP 1mg
EUR 195

MED15 cloning plasmid

CSB-CL842753HU-10ug 10ug
EUR 738
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2247
  • Sequence: atggacgtttccgggcaagagaccgactggcggagcaccgccttccggcagaagctggtcagtcaaatcgaggatgccatgaggaaagctggtgtggcacacagtaaatccagcaaggatatggagagccatgttttcctgaaggccaagacccgggacgaatacctttctctcg
  • Show more
Description: A cloning plasmid for the MED15 gene.

Anti-MED15 Antibody (monoclonal, 6F4)

M03568 100ug/vial
EUR 294

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody

abx235089-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


ELI-23717h 96 Tests
EUR 824


EF000723 96 Tests
EUR 689

Mouse Med15 ELISA KIT

ELI-42964m 96 Tests
EUR 865

Human MED15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MED15 Recombinant Protein (Human)

RP019075 100 ug Ask for price

MED15 Recombinant Protein (Rat)

RP211271 100 ug Ask for price

MED15 Recombinant Protein (Mouse)

RP150029 100 ug Ask for price

MED15 Recombinant Protein (Mouse)

RP150032 100 ug Ask for price

Anti-PCQAP / MED15 (4A4)

YF-MA11516 100 ug
EUR 363
Description: Mouse monoclonal to PCQAP / MED15

Mediator Complex Subunit 15 (MED15) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MED15 ORF Vector (Human) (pORF)

ORF006359 1.0 ug DNA
EUR 95

Med15 ORF Vector (Mouse) (pORF)

ORF050011 1.0 ug DNA
EUR 506

Med15 ORF Vector (Mouse) (pORF)

ORF050012 1.0 ug DNA
EUR 506

Med15 ORF Vector (Rat) (pORF)

ORF070425 1.0 ug DNA
EUR 506

MED15 sgRNA CRISPR Lentivector set (Human)

K1286201 3 x 1.0 ug
EUR 339

Med15 sgRNA CRISPR Lentivector set (Rat)

K6130501 3 x 1.0 ug
EUR 339

Med15 sgRNA CRISPR Lentivector set (Mouse)

K4931201 3 x 1.0 ug
EUR 339

Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit

E04M0068-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit

E04M0068-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit

E04M0068-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MED15 sgRNA CRISPR Lentivector (Human) (Target 1)

K1286202 1.0 ug DNA
EUR 154

MED15 sgRNA CRISPR Lentivector (Human) (Target 2)

K1286203 1.0 ug DNA
EUR 154

MED15 sgRNA CRISPR Lentivector (Human) (Target 3)

K1286204 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6130502 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6130503 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6130504 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4931202 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4931203 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4931204 1.0 ug DNA
EUR 154

MED15 Protein Vector (Rat) (pPB-C-His)

PV281698 500 ng
EUR 1166

MED15 Protein Vector (Rat) (pPB-N-His)

PV281699 500 ng
EUR 1166

MED15 Protein Vector (Rat) (pPM-C-HA)

PV281700 500 ng
EUR 1166

MED15 Protein Vector (Rat) (pPM-C-His)

PV281701 500 ng
EUR 1166

MED15 Protein Vector (Human) (pPB-C-His)

PV025433 500 ng
EUR 329

MED15 Protein Vector (Human) (pPB-N-His)

PV025434 500 ng
EUR 329

MED15 Protein Vector (Human) (pPM-C-HA)

PV025435 500 ng
EUR 329

MED15 Protein Vector (Human) (pPM-C-His)

PV025436 500 ng
EUR 329

MED15 Protein Vector (Mouse) (pPB-C-His)

PV200042 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPB-N-His)

PV200043 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-HA)

PV200044 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-His)

PV200045 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPB-C-His)

PV200046 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPB-N-His)

PV200047 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-HA)

PV200048 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-His)

PV200049 500 ng
EUR 1065

Med15 3'UTR GFP Stable Cell Line

TU163049 1.0 ml Ask for price

Med15 3'UTR Luciferase Stable Cell Line

TU213021 1.0 ml Ask for price

MED15 3'UTR Luciferase Stable Cell Line

TU013185 1.0 ml
EUR 2333

Med15 3'UTR Luciferase Stable Cell Line

TU113049 1.0 ml Ask for price

MED15 3'UTR GFP Stable Cell Line

TU063185 1.0 ml
EUR 2333

Med15 3'UTR GFP Stable Cell Line

TU263021 1.0 ml Ask for price

Human Mediator Complex Subunit 15 (MED15) ELISA Kit

abx381394-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

MED15 Rabbit Polyclonal Antibody