MED15 Rabbit Polyclonal Antibody

MED15 Rabbit Polyclonal Antibody

 

MED15 Polyclonal Antibody
ABP59250-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590

MED15 Polyclonal Antibody
ABP59250-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590

MED15 Polyclonal Antibody
ES9787-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MED15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED15 Polyclonal Antibody
ES9787-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MED15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MED15 Rabbit pAb
A18238-100ul 100 ul
EUR 308

MED15 Rabbit pAb
A18238-200ul 200 ul
EUR 459

MED15 Rabbit pAb
A18238-20ul 20 ul
EUR 183

MED15 Rabbit pAb
A18238-50ul 50 ul
EUR 223

MED15 antibody
70R-18461 50 ul
EUR 435
Description: Rabbit polyclonal MED15 antibody

MED15 Antibody
40263-100ul 100ul
EUR 252

MED15 Antibody
1-CSB-PA842753LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

MED15 Antibody
1-CSB-PA087753
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

MED15 Antibody
DF9613 200ul
EUR 304
Description: MED15 Antibody detects endogenous levels of total MED15.

MED15 Antibody
1-CSB-PA267854
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED15 Antibody
1-CSB-PA179506
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED15 Antibody
1-CSB-PA193960
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MED15 antibody
70R-50994 100 ul
EUR 244
Description: Purified Polyclonal MED15 antibody

MED15 Antibody
1-CSB-PA013648GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MED15 Antibody
ABD9613 100 ug
EUR 438

MED15 Polyclonal Antibody, HRP Conjugated
A69092 100 ?g
EUR 628.55
Description: Ask the seller for details

MED15 Polyclonal Antibody, FITC Conjugated
A69093 100 ?g
EUR 628.55
Description: The best epigenetics products

MED15 Polyclonal Antibody, Biotin Conjugated
A69094 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Anti-MED15 Antibody
A03568-1 100ug/vial
EUR 334

MED15 Conjugated Antibody
C40263 100ul
EUR 397

anti- MED15 antibody
FNab05089 100µg
EUR 585
  • Immunogen: mediator complex subunit 15
  • Uniprot ID: Q96RN5
  • Gene ID: 51586
  • Research Area: Metabolism
Description: Antibody raised against MED15

Anti-MED15 antibody
PAab05089 100 ug
EUR 412

Anti-MED15 antibody
STJ11100195 100 µl
EUR 277
Description: The protein encoded by this gene is a subunit of the multiprotein complexes PC2 and ARC/DRIP and may function as a transcriptional coactivator in RNA polymerase II transcription. This gene contains stretches of trinucleotide repeats and is located in the chromosome 22 region which is deleted in DiGeorge syndrome. Alternative splicing results in multiple transcript variants.

Anti-MED15 antibody
STJ190945 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MED15

MED15 siRNA
20-abx923838
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MED15 Antibody, HRP conjugated
1-CSB-PA842753LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MED15 Antibody, FITC conjugated
1-CSB-PA842753LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MED15 Antibody, Biotin conjugated
1-CSB-PA842753LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-PCQAP / MED15 antibody
STJ71834 100 µg
EUR 359

MED15 Blocking Peptide
DF9613-BP 1mg
EUR 195

MED15 Blocking Peptide
20-abx063869
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MED15 cloning plasmid
CSB-CL842753HU-10ug 10ug
EUR 738
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2247
  • Sequence: atggacgtttccgggcaagagaccgactggcggagcaccgccttccggcagaagctggtcagtcaaatcgaggatgccatgaggaaagctggtgtggcacacagtaaatccagcaaggatatggagagccatgttttcctgaaggccaagacccgggacgaatacctttctctcg
  • Show more
Description: A cloning plasmid for the MED15 gene.

Anti-MED15 Antibody (monoclonal, 6F4)
M03568 100ug/vial
EUR 294

Human MED15 ELISA KIT
ELI-23717h 96 Tests
EUR 824

MED15 ELISA KIT|Human
EF000723 96 Tests
EUR 689

Mouse Med15 ELISA KIT
ELI-42964m 96 Tests
EUR 865

Human MED15 shRNA Plasmid
20-abx959845
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MED15 Recombinant Protein (Human)
RP019075 100 ug Ask for price

MED15 Recombinant Protein (Mouse)
RP150029 100 ug Ask for price

MED15 Recombinant Protein (Mouse)
RP150032 100 ug Ask for price

MED15 Recombinant Protein (Rat)
RP211271 100 ug Ask for price

Anti-PCQAP / MED15 (4A4)
YF-MA11516 100 ug
EUR 363
Description: Mouse monoclonal to PCQAP / MED15

Mediator Complex Subunit 15 (MED15) Antibody
20-abx008144
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody
20-abx212562
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody
20-abx212637
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody
20-abx212761
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody
20-abx212762
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody
20-abx113638
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody
abx235089-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mediator Complex Subunit 15 (MED15) Antibody
20-abx338372
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody (HRP)
20-abx336459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody (FITC)
20-abx336460
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mediator Complex Subunit 15 (MED15) Antibody (Biotin)
20-abx336461
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Med15 ORF Vector (Rat) (pORF)
ORF070425 1.0 ug DNA
EUR 506

MED15 ORF Vector (Human) (pORF)
ORF006359 1.0 ug DNA
EUR 95

Med15 ORF Vector (Mouse) (pORF)
ORF050011 1.0 ug DNA
EUR 506

Med15 ORF Vector (Mouse) (pORF)
ORF050012 1.0 ug DNA
EUR 506

Med15 sgRNA CRISPR Lentivector set (Mouse)
K4931201 3 x 1.0 ug
EUR 339

Med15 sgRNA CRISPR Lentivector set (Rat)
K6130501 3 x 1.0 ug
EUR 339

MED15 sgRNA CRISPR Lentivector set (Human)
K1286201 3 x 1.0 ug
EUR 339

Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit
E04M0068-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit
E04M0068-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit
E04M0068-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Med15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4931202 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4931203 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4931204 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6130502 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6130503 1.0 ug DNA
EUR 154

Med15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6130504 1.0 ug DNA
EUR 154

MED15 sgRNA CRISPR Lentivector (Human) (Target 1)
K1286202 1.0 ug DNA
EUR 154

MED15 sgRNA CRISPR Lentivector (Human) (Target 2)
K1286203 1.0 ug DNA
EUR 154

MED15 sgRNA CRISPR Lentivector (Human) (Target 3)
K1286204 1.0 ug DNA
EUR 154

MED15 Protein Vector (Rat) (pPB-C-His)
PV281698 500 ng
EUR 1166

MED15 Protein Vector (Rat) (pPB-N-His)
PV281699 500 ng
EUR 1166

MED15 Protein Vector (Rat) (pPM-C-HA)
PV281700 500 ng
EUR 1166

MED15 Protein Vector (Rat) (pPM-C-His)
PV281701 500 ng
EUR 1166

MED15 Protein Vector (Mouse) (pPB-C-His)
PV200042 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPB-N-His)
PV200043 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-HA)
PV200044 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-His)
PV200045 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPB-C-His)
PV200046 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPB-N-His)
PV200047 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-HA)
PV200048 500 ng
EUR 1065

MED15 Protein Vector (Mouse) (pPM-C-His)
PV200049 500 ng
EUR 1065

MED15 Protein Vector (Human) (pPB-C-His)
PV025433 500 ng
EUR 329

MED15 Protein Vector (Human) (pPB-N-His)
PV025434 500 ng
EUR 329

MED15 Protein Vector (Human) (pPM-C-HA)
PV025435 500 ng
EUR 329

MED15 Protein Vector (Human) (pPM-C-His)
PV025436 500 ng
EUR 329

Med15 3'UTR Luciferase Stable Cell Line
TU113049 1.0 ml Ask for price

Med15 3'UTR GFP Stable Cell Line
TU163049 1.0 ml Ask for price

Med15 3'UTR Luciferase Stable Cell Line
TU213021 1.0 ml Ask for price

Med15 3'UTR GFP Stable Cell Line
TU263021 1.0 ml Ask for price

MED15 3'UTR GFP Stable Cell Line
TU063185 1.0 ml
EUR 2333

MED15 3'UTR Luciferase Stable Cell Line
TU013185 1.0 ml
EUR 2333

Human Mediator Complex Subunit 15 (MED15) ELISA Kit
abx381394-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

MED15 Rabbit Polyclonal Antibody