MED15 Rabbit Polyclonal Antibody
MED15 Polyclonal Antibody |
ABP59250-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
- Applications tips:
|
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590 |
MED15 Polyclonal Antibody |
ABP59250-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
- Applications tips:
|
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590 |
MED15 Polyclonal Antibody |
ABP59250-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590
- Applications tips:
|
Description: A polyclonal antibody for detection of MED15 from Human, Mouse. This MED15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MED15 protein at amino acid sequence of 510-590 |
MED15 Polyclonal Antibody |
A69091 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
MED15 Rabbit pAb |
A18238-100ul |
Abclonal |
100 ul |
EUR 308 |
MED15 Rabbit pAb |
A18238-200ul |
Abclonal |
200 ul |
EUR 459 |
MED15 Rabbit pAb |
A18238-20ul |
Abclonal |
20 ul |
EUR 183 |
MED15 Rabbit pAb |
A18238-50ul |
Abclonal |
50 ul |
EUR 223 |
MED15 antibody |
70R-50994 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MED15 antibody |
MED15 Antibody |
40263-100ul |
SAB |
100ul |
EUR 252 |
MED15 antibody |
70R-18461 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MED15 antibody |
MED15 Antibody |
DF9613 |
Affbiotech |
200ul |
EUR 304 |
Description: MED15 Antibody detects endogenous levels of total MED15. |
MED15 Antibody |
1-CSB-PA013648GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
MED15 Antibody |
1-CSB-PA842753LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
MED15 Antibody |
1-CSB-PA267854 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
MED15 Antibody |
1-CSB-PA179506 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
MED15 Antibody |
1-CSB-PA193960 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
MED15 Antibody |
1-CSB-PA087753 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100 |
MED15 Polyclonal Antibody, HRP Conjugated |
A69092 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
MED15 Polyclonal Antibody, FITC Conjugated |
A69093 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
MED15 Polyclonal Antibody, Biotin Conjugated |
A69094 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
MED15 Conjugated Antibody |
C40263 |
SAB |
100ul |
EUR 397 |
anti- MED15 antibody |
FNab05089 |
FN Test |
100µg |
EUR 585 |
- Immunogen: mediator complex subunit 15
- Uniprot ID: Q96RN5
- Gene ID: 51586
- Research Area: Metabolism
|
Description: Antibody raised against MED15 |
Anti-MED15 Antibody |
A03568-1 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-MED15 antibody |
STJ11100195 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a subunit of the multiprotein complexes PC2 and ARC/DRIP and may function as a transcriptional coactivator in RNA polymerase II transcription. This gene contains stretches of trinucleotide repeats and is located in the chromosome 22 region which is deleted in DiGeorge syndrome. Alternative splicing results in multiple transcript variants. |
Anti-MED15 antibody |
STJ190945 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MED15 |
MED15 siRNA |
20-abx923838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED15 Antibody, HRP conjugated |
1-CSB-PA842753LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MED15 Antibody, FITC conjugated |
1-CSB-PA842753LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MED15 Antibody, Biotin conjugated |
1-CSB-PA842753LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MED15. Recognizes MED15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MED15 Blocking Peptide |
20-abx063869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MED15 Blocking Peptide |
DF9613-BP |
Affbiotech |
1mg |
EUR 195 |
MED15 cloning plasmid |
CSB-CL842753HU-10ug |
Cusabio |
10ug |
EUR 738 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2247
- Sequence: atggacgtttccgggcaagagaccgactggcggagcaccgccttccggcagaagctggtcagtcaaatcgaggatgccatgaggaaagctggtgtggcacacagtaaatccagcaaggatatggagagccatgttttcctgaaggccaagacccgggacgaatacctttctctcg
- Show more
|
Description: A cloning plasmid for the MED15 gene. |
Anti-MED15 Antibody (monoclonal, 6F4) |
M03568 |
BosterBio |
100ug/vial |
EUR 294 |
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx113638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx008144 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx338372 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
abx235089-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx212562 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx212637 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx212761 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody |
20-abx212762 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human MED15 shRNA Plasmid |
20-abx959845 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MED15 Recombinant Protein (Human) |
RP019075 |
ABM |
100 ug |
Ask for price |
MED15 Recombinant Protein (Rat) |
RP211271 |
ABM |
100 ug |
Ask for price |
MED15 Recombinant Protein (Mouse) |
RP150029 |
ABM |
100 ug |
Ask for price |
MED15 Recombinant Protein (Mouse) |
RP150032 |
ABM |
100 ug |
Ask for price |
Anti-PCQAP / MED15 (4A4) |
YF-MA11516 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCQAP / MED15 |
Mediator Complex Subunit 15 (MED15) Antibody (HRP) |
20-abx336459 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody (FITC) |
20-abx336460 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mediator Complex Subunit 15 (MED15) Antibody (Biotin) |
20-abx336461 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
MED15 ORF Vector (Human) (pORF) |
ORF006359 |
ABM |
1.0 ug DNA |
EUR 95 |
Med15 ORF Vector (Mouse) (pORF) |
ORF050011 |
ABM |
1.0 ug DNA |
EUR 506 |
Med15 ORF Vector (Mouse) (pORF) |
ORF050012 |
ABM |
1.0 ug DNA |
EUR 506 |
Med15 ORF Vector (Rat) (pORF) |
ORF070425 |
ABM |
1.0 ug DNA |
EUR 506 |
MED15 sgRNA CRISPR Lentivector set (Human) |
K1286201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Med15 sgRNA CRISPR Lentivector set (Rat) |
K6130501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Med15 sgRNA CRISPR Lentivector set (Mouse) |
K4931201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit |
E04M0068-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit |
E04M0068-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) ELISA kit |
E04M0068-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mediator of RNA polymerase II transcription subunit 15(MED15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
MED15 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1286202 |
ABM |
1.0 ug DNA |
EUR 154 |
MED15 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1286203 |
ABM |
1.0 ug DNA |
EUR 154 |
MED15 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1286204 |
ABM |
1.0 ug DNA |
EUR 154 |
Med15 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6130502 |
ABM |
1.0 ug DNA |
EUR 154 |
Med15 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6130503 |
ABM |
1.0 ug DNA |
EUR 154 |
Med15 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6130504 |
ABM |
1.0 ug DNA |
EUR 154 |
Med15 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4931202 |
ABM |
1.0 ug DNA |
EUR 154 |
Med15 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4931203 |
ABM |
1.0 ug DNA |
EUR 154 |
Med15 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4931204 |
ABM |
1.0 ug DNA |
EUR 154 |
MED15 Protein Vector (Rat) (pPB-C-His) |
PV281698 |
ABM |
500 ng |
EUR 1166 |
MED15 Protein Vector (Rat) (pPB-N-His) |
PV281699 |
ABM |
500 ng |
EUR 1166 |
MED15 Protein Vector (Rat) (pPM-C-HA) |
PV281700 |
ABM |
500 ng |
EUR 1166 |
MED15 Protein Vector (Rat) (pPM-C-His) |
PV281701 |
ABM |
500 ng |
EUR 1166 |
MED15 Protein Vector (Human) (pPB-C-His) |
PV025433 |
ABM |
500 ng |
EUR 329 |
MED15 Protein Vector (Human) (pPB-N-His) |
PV025434 |
ABM |
500 ng |
EUR 329 |
MED15 Protein Vector (Human) (pPM-C-HA) |
PV025435 |
ABM |
500 ng |
EUR 329 |
MED15 Protein Vector (Human) (pPM-C-His) |
PV025436 |
ABM |
500 ng |
EUR 329 |
MED15 Protein Vector (Mouse) (pPB-C-His) |
PV200042 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPB-N-His) |
PV200043 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPM-C-HA) |
PV200044 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPM-C-His) |
PV200045 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPB-C-His) |
PV200046 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPB-N-His) |
PV200047 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPM-C-HA) |
PV200048 |
ABM |
500 ng |
EUR 1065 |
MED15 Protein Vector (Mouse) (pPM-C-His) |
PV200049 |
ABM |
500 ng |
EUR 1065 |
Med15 3'UTR GFP Stable Cell Line |
TU163049 |
ABM |
1.0 ml |
Ask for price |
Med15 3'UTR Luciferase Stable Cell Line |
TU213021 |
ABM |
1.0 ml |
Ask for price |
MED15 3'UTR Luciferase Stable Cell Line |
TU013185 |
ABM |
1.0 ml |
EUR 2333 |
Med15 3'UTR Luciferase Stable Cell Line |
TU113049 |
ABM |
1.0 ml |
Ask for price |
MED15 3'UTR GFP Stable Cell Line |
TU063185 |
ABM |
1.0 ml |
EUR 2333 |
Med15 3'UTR GFP Stable Cell Line |
TU263021 |
ABM |
1.0 ml |
Ask for price |
Human Mediator Complex Subunit 15 (MED15) ELISA Kit |
abx381394-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
MED15 Rabbit Polyclonal Antibody