MARCO Rabbit Polyclonal Antibody

MARCO Rabbit Polyclonal Antibody

 

MARCO Polyclonal Antibody

ABP59218-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody

ES9781-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MARCO Polyclonal Antibody

ES9781-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MARCO Rabbit pAb

A10048-100ul 100 ul
EUR 308

MARCO Rabbit pAb

A10048-200ul 200 ul
EUR 459

MARCO Rabbit pAb

A10048-20ul 20 ul
EUR 183

MARCO Rabbit pAb

A10048-50ul 50 ul
EUR 223

MARCO Polyclonal Conjugated Antibody

C27273 100ul
EUR 397

Macrophage Receptor MARCO (MARCO) Antibody

20-abx135966
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrophage Receptor MARCO (MARCO) Antibody

20-abx322023
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MARCO Antibody

1-CSB-PA880072ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MARCO. Recognizes MARCO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MARCO antibody

70R-8509 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MARCO antibody

MARCO antibody

70R-6455 50 ug
EUR 467
Description: Rabbit polyclonal MARCO antibody raised against the N terminal of MARCO

Anti-MARCO antibody

STJ112088 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains.

Anti-MARCO antibody

STJ190939 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MARCO

MARCO siRNA

20-abx923573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MARCO siRNA

20-abx923574
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse Macrophage receptor MARCO, Marco ELISA KIT

ELI-16328m 96 Tests
EUR 865

Human Macrophage Receptor MARCO (MARCO) ELISA Kit

20-abx385113
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Macrophage Receptor MARCO (MARCO) ELISA Kit

abx389793-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Macrophage receptor MARCO, MARCO ELISA KIT

ELI-39124h 96 Tests
EUR 824

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)

CU63-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)

CU63-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)

CU63-500ug 500ug
EUR 1166
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)

CU63-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

MARCO Blocking Peptide

33R-3464 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-8509

MARCO Blocking Peptide

33R-7477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-6455

MARCO cloning plasmid

CSB-CL880072HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1563
  • Sequence: atgagaaataagaaaattctcaaggaggacgagctcttgagtgagacccaacaagctgcttttcaccaaattgcaatggagcctttcgaaatcaatgttccaaagcccaagaggagaaatggggtgaacttctccctagctgtggtggtcatctacctgatcctgctcaccgctg
  • Show more
Description: A cloning plasmid for the MARCO gene.

Marco ELISA Kit| Mouse Macrophage receptor MARCO ELISA Kit

EF015428 96 Tests
EUR 689

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse)

4-PAC614Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO)

MARCO ELISA KIT|Human

EF005227 96 Tests
EUR 689

Human MARCO shRNA Plasmid

20-abx955715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MARCO shRNA Plasmid

20-abx971431
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MARCO Recombinant Protein (Human)

RP018841 100 ug Ask for price

MARCO Recombinant Protein (Mouse)

RP149483 100 ug Ask for price

MARCO Recombinant Protein (Rat)

RP210899 100 ug Ask for price

Mouse Anti Hamster Marco Monoclonal Antibody

DMABT-47716MH 0.25 mg
EUR 741

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC

4-PAC614Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Biotinylated

4-PAC614Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Cy3

4-PAC614Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), FITC

4-PAC614Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), HRP

4-PAC614Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), PE

4-PAC614Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat)

4-PAC614Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO)

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC614Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly366~Ser518)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), APC

4-PAC614Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAC614Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), Cy3

4-PAC614Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), FITC

4-PAC614Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), HRP

4-PAC614Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), PE

4-PAC614Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody

20-abx131562
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody

20-abx131563
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Marco ORF Vector (Rat) (pORF)

ORF070301 1.0 ug DNA
EUR 506

MARCO ORF Vector (Human) (pORF)

ORF006281 1.0 ug DNA
EUR 95

Marco ORF Vector (Mouse) (pORF)

ORF049829 1.0 ug DNA
EUR 506

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAC614Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MARCO (Gly367~Arg519)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7.

Marco sgRNA CRISPR Lentivector set (Rat)

K6667901 3 x 1.0 ug
EUR 339

Marco sgRNA CRISPR Lentivector set (Mouse)

K3658301 3 x 1.0 ug
EUR 339

MARCO sgRNA CRISPR Lentivector set (Human)

K1270701 3 x 1.0 ug
EUR 339

Marco sgRNA CRISPR Lentivector (Rat) (Target 1)

K6667902 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 2)

K6667903 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 3)

K6667904 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3658302 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3658303 1.0 ug DNA
EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3658304 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 1)

K1270702 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 2)

K1270703 1.0 ug DNA
EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 3)

K1270704 1.0 ug DNA
EUR 154

MARCO Protein Vector (Human) (pPB-C-His)

PV025121 500 ng
EUR 329

MARCO Protein Vector (Human) (pPB-N-His)

PV025122 500 ng
EUR 329

MARCO Protein Vector (Human) (pPM-C-HA)

PV025123 500 ng
EUR 329

MARCO Protein Vector (Human) (pPM-C-His)

PV025124 500 ng
EUR 329

MARCO Protein Vector (Rat) (pPB-C-His)

PV281202 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPB-N-His)

PV281203 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPM-C-HA)

PV281204 500 ng
EUR 603

MARCO Protein Vector (Rat) (pPM-C-His)

PV281205 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPB-C-His)

PV199314 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPB-N-His)

PV199315 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPM-C-HA)

PV199316 500 ng
EUR 603

MARCO Protein Vector (Mouse) (pPM-C-His)

PV199317 500 ng
EUR 603

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)

4-RPC614Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q60754
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Macrophage Receptor With Collagenous Structure expressed in: E.coli

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)

4-RPC614Ra01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: M0R9F7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Macrophage Receptor With Collagenous Structure expressed in: E.coli

Marco 3'UTR Luciferase Stable Cell Line

TU112920 1.0 ml Ask for price

Marco 3'UTR GFP Stable Cell Line

TU162920 1.0 ml Ask for price

Marco 3'UTR Luciferase Stable Cell Line

TU212886 1.0 ml Ask for price

Marco 3'UTR GFP Stable Cell Line

TU262886 1.0 ml Ask for price

MARCO 3'UTR GFP Stable Cell Line

TU063026 1.0 ml
EUR 1394

MARCO 3'UTR Luciferase Stable Cell Line

TU013026 1.0 ml
EUR 1394

Mouse Macrophage Receptor With Collagenous Structure (MARCO) Protein

20-abx650074
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Macrophage Receptor With Collagenous Structure (MARCO) Protein

20-abx650075
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV622369 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV622373 1.0 ug DNA
EUR 682

MARCO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV622374 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

MARCO Rabbit Polyclonal Antibody