MARCO Rabbit Polyclonal Antibody
MARCO Polyclonal Antibody |
ABP59218-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460 |
MARCO Polyclonal Antibody |
27273-100ul |
SAB |
100ul |
EUR 252 |
MARCO Polyclonal Antibody |
27273-50ul |
SAB |
50ul |
EUR 187 |
MARCO Rabbit pAb |
A10048-100ul |
Abclonal |
100 ul |
EUR 308 |
MARCO Rabbit pAb |
A10048-200ul |
Abclonal |
200 ul |
EUR 459 |
MARCO Rabbit pAb |
A10048-20ul |
Abclonal |
20 ul |
EUR 183 |
MARCO Rabbit pAb |
A10048-50ul |
Abclonal |
50 ul |
EUR 223 |
MARCO Polyclonal Conjugated Antibody |
C27273 |
SAB |
100ul |
EUR 397 |
Macrophage Receptor MARCO (MARCO) Antibody |
20-abx135966 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Macrophage Receptor MARCO (MARCO) Antibody |
20-abx322023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCO antibody |
70R-8509 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MARCO antibody |
MARCO antibody |
70R-6455 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal MARCO antibody raised against the N terminal of MARCO |
MARCO Antibody |
1-CSB-PA880072ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MARCO. Recognizes MARCO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Anti-MARCO antibody |
STJ112088 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains. |
Anti-MARCO antibody |
STJ190939 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MARCO |
MARCO siRNA |
20-abx923573 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MARCO siRNA |
20-abx923574 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse Macrophage receptor MARCO, Marco ELISA KIT |
ELI-16328m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Macrophage receptor MARCO, MARCO ELISA KIT |
ELI-39124h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Macrophage Receptor MARCO (MARCO) ELISA Kit |
20-abx385113 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Mouse Macrophage Receptor MARCO (MARCO) ELISA Kit |
abx389793-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His) |
CU63-10ug |
Novoprotein |
10ug |
EUR 131 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His) |
CU63-1mg |
Novoprotein |
1mg |
EUR 1674 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His) |
CU63-500ug |
Novoprotein |
500ug |
EUR 1166 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His) |
CU63-50ug |
Novoprotein |
50ug |
EUR 273 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
MARCO Blocking Peptide |
33R-3464 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-8509 |
MARCO Blocking Peptide |
33R-7477 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-6455 |
MARCO cloning plasmid |
CSB-CL880072HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1563
- Sequence: atgagaaataagaaaattctcaaggaggacgagctcttgagtgagacccaacaagctgcttttcaccaaattgcaatggagcctttcgaaatcaatgttccaaagcccaagaggagaaatggggtgaacttctccctagctgtggtggtcatctacctgatcctgctcaccgctg
- Show more
|
Description: A cloning plasmid for the MARCO gene. |
Marco ELISA Kit| Mouse Macrophage receptor MARCO ELISA Kit |
EF015428 |
Lifescience Market |
96 Tests |
EUR 689 |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse) |
4-PAC614Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO) |
Human MARCO shRNA Plasmid |
20-abx955715 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MARCO shRNA Plasmid |
20-abx971431 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MARCO Recombinant Protein (Human) |
RP018841 |
ABM |
100 ug |
Ask for price |
MARCO Recombinant Protein (Rat) |
RP210899 |
ABM |
100 ug |
Ask for price |
MARCO Recombinant Protein (Mouse) |
RP149483 |
ABM |
100 ug |
Ask for price |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC |
4-PAC614Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC614Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Cy3 |
4-PAC614Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), FITC |
4-PAC614Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), HRP |
4-PAC614Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), PE |
4-PAC614Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat) |
4-PAC614Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO) |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC614Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly366~Ser518)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), APC |
4-PAC614Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAC614Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAC614Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), FITC |
4-PAC614Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), HRP |
4-PAC614Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP. |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), PE |
4-PAC614Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE. |
Macrophage Receptor With Collagenous Structure (MARCO) Antibody |
20-abx131562 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Macrophage Receptor With Collagenous Structure (MARCO) Antibody |
20-abx131563 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MARCO ORF Vector (Human) (pORF) |
ORF006281 |
ABM |
1.0 ug DNA |
EUR 95 |
Marco ORF Vector (Mouse) (pORF) |
ORF049829 |
ABM |
1.0 ug DNA |
EUR 506 |
Marco ORF Vector (Rat) (pORF) |
ORF070301 |
ABM |
1.0 ug DNA |
EUR 506 |
Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAC614Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MARCO (Gly367~Arg519)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7. |
MARCO sgRNA CRISPR Lentivector set (Human) |
K1270701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Marco sgRNA CRISPR Lentivector set (Mouse) |
K3658301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Marco sgRNA CRISPR Lentivector set (Rat) |
K6667901 |
ABM |
3 x 1.0 ug |
EUR 339 |
MARCO sgRNA CRISPR Lentivector (Human) (Target 1) |
K1270702 |
ABM |
1.0 ug DNA |
EUR 154 |
MARCO sgRNA CRISPR Lentivector (Human) (Target 2) |
K1270703 |
ABM |
1.0 ug DNA |
EUR 154 |
MARCO sgRNA CRISPR Lentivector (Human) (Target 3) |
K1270704 |
ABM |
1.0 ug DNA |
EUR 154 |
Marco sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3658302 |
ABM |
1.0 ug DNA |
EUR 154 |
Marco sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3658303 |
ABM |
1.0 ug DNA |
EUR 154 |
Marco sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3658304 |
ABM |
1.0 ug DNA |
EUR 154 |
Marco sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6667902 |
ABM |
1.0 ug DNA |
EUR 154 |
Marco sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6667903 |
ABM |
1.0 ug DNA |
EUR 154 |
Marco sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6667904 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Macrophage Receptor With Collagenous Structure (MARCO) |
4-RPC614Mu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q60754
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Macrophage Receptor With Collagenous Structure expressed in: E.coli |
Recombinant Macrophage Receptor With Collagenous Structure (MARCO) |
4-RPC614Ra01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: M0R9F7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Macrophage Receptor With Collagenous Structure expressed in: E.coli |
MARCO Protein Vector (Rat) (pPB-C-His) |
PV281202 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Rat) (pPB-N-His) |
PV281203 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Rat) (pPM-C-HA) |
PV281204 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Rat) (pPM-C-His) |
PV281205 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Human) (pPB-C-His) |
PV025121 |
ABM |
500 ng |
EUR 329 |
MARCO Protein Vector (Human) (pPB-N-His) |
PV025122 |
ABM |
500 ng |
EUR 329 |
MARCO Protein Vector (Human) (pPM-C-HA) |
PV025123 |
ABM |
500 ng |
EUR 329 |
MARCO Protein Vector (Human) (pPM-C-His) |
PV025124 |
ABM |
500 ng |
EUR 329 |
MARCO Protein Vector (Mouse) (pPB-C-His) |
PV199314 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Mouse) (pPB-N-His) |
PV199315 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Mouse) (pPM-C-HA) |
PV199316 |
ABM |
500 ng |
EUR 603 |
MARCO Protein Vector (Mouse) (pPM-C-His) |
PV199317 |
ABM |
500 ng |
EUR 603 |
Marco 3'UTR GFP Stable Cell Line |
TU162920 |
ABM |
1.0 ml |
Ask for price |
Marco 3'UTR Luciferase Stable Cell Line |
TU212886 |
ABM |
1.0 ml |
Ask for price |
MARCO 3'UTR Luciferase Stable Cell Line |
TU013026 |
ABM |
1.0 ml |
EUR 1394 |
Marco 3'UTR Luciferase Stable Cell Line |
TU112920 |
ABM |
1.0 ml |
Ask for price |
MARCO 3'UTR GFP Stable Cell Line |
TU063026 |
ABM |
1.0 ml |
EUR 1394 |
Marco 3'UTR GFP Stable Cell Line |
TU262886 |
ABM |
1.0 ml |
Ask for price |
Mouse Macrophage Receptor With Collagenous Structure (MARCO) Protein |
20-abx650074 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Macrophage Receptor With Collagenous Structure (MARCO) Protein |
20-abx650075 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV622369 |
ABM |
1.0 ug DNA |
EUR 682 |
MARCO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV622373 |
ABM |
1.0 ug DNA |
EUR 682 |
MARCO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV622374 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MARCO Rabbit Polyclonal Antibody