MARCO Rabbit Polyclonal Antibody

MARCO Rabbit Polyclonal Antibody

 

MARCO Polyclonal Antibody
ABP59218-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460 Applications tips:
Description: A polyclonal antibody for detection of MARCO from Human, Mouse. This MARCO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MARCO protein at amino acid sequence of 380-460

MARCO Polyclonal Antibody
ES9781-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MARCO Polyclonal Antibody
ES9781-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MARCO from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MARCO Rabbit pAb
A10048-100ul	Abclonal	100 ul	EUR 308

MARCO Rabbit pAb
A10048-200ul	Abclonal	200 ul	EUR 459

MARCO Rabbit pAb
A10048-20ul	Abclonal	20 ul	EUR 183

MARCO Rabbit pAb
A10048-50ul	Abclonal	50 ul	EUR 223

MARCO Polyclonal Conjugated Antibody
C27273	SAB	100ul	EUR 397

Macrophage Receptor MARCO (MARCO) Antibody
20-abx135966	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Macrophage Receptor MARCO (MARCO) Antibody
20-abx322023	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

MARCO Antibody
1-CSB-PA880072ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MARCO. Recognizes MARCO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MARCO antibody
70R-8509	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal MARCO antibody

MARCO antibody
70R-6455	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MARCO antibody raised against the N terminal of MARCO

Anti-MARCO antibody
STJ112088	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains.

Anti-MARCO antibody
STJ190939	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MARCO

MARCO siRNA
20-abx923573	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MARCO siRNA
20-abx923574	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mouse Macrophage receptor MARCO, Marco ELISA KIT
ELI-16328m	Lifescience Market	96 Tests	EUR 865

Human Macrophage Receptor MARCO (MARCO) ELISA Kit
20-abx385113	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Mouse Macrophage Receptor MARCO (MARCO) ELISA Kit
abx389793-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Macrophage receptor MARCO, MARCO ELISA KIT
ELI-39124h	Lifescience Market	96 Tests	EUR 824

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)
CU63-10ug	Novoprotein	10ug	EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)
CU63-1mg	Novoprotein	1mg	EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)
CU63-500ug	Novoprotein	500ug	EUR 1166
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Macrophage Receptor MARCO/MARCO (N-8His)
CU63-50ug	Novoprotein	50ug	EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

MARCO Blocking Peptide
33R-3464	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-8509

MARCO Blocking Peptide
33R-7477	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MARCO antibody, catalog no. 70R-6455

MARCO cloning plasmid
CSB-CL880072HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1563 Sequence: atgagaaataagaaaattctcaaggaggacgagctcttgagtgagacccaacaagctgcttttcaccaaattgcaatggagcctttcgaaatcaatgttccaaagcccaagaggagaaatggggtgaacttctccctagctgtggtggtcatctacctgatcctgctcaccgctg Show more
Description: A cloning plasmid for the MARCO gene.

Marco ELISA Kit| Mouse Macrophage receptor MARCO ELISA Kit
EF015428	Lifescience Market	96 Tests	EUR 689

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse)
4-PAC614Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO)

MARCO ELISA KIT|Human
EF005227	Lifescience Market	96 Tests	EUR 689

Human MARCO shRNA Plasmid
20-abx955715	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MARCO shRNA Plasmid
20-abx971431	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MARCO Recombinant Protein (Human)
RP018841	ABM	100 ug	Ask for price

MARCO Recombinant Protein (Mouse)
RP149483	ABM	100 ug	Ask for price

MARCO Recombinant Protein (Rat)
RP210899	ABM	100 ug	Ask for price

Mouse Anti Hamster Marco Monoclonal Antibody
DMABT-47716MH	Creative Diagnostics	0.25 mg	EUR 741

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC
4-PAC614Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Biotinylated
4-PAC614Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), Cy3
4-PAC614Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), FITC
4-PAC614Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), HRP
4-PAC614Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), PE
4-PAC614Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat)
4-PAC614Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO)

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC614Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly366~Ser518) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), APC
4-PAC614Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAC614Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Biotin.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), Cy3
4-PAC614Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with Cy3.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), FITC
4-PAC614Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with FITC.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), HRP
4-PAC614Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with HRP.

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), PE
4-PAC614Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with PE.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody
20-abx131562	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Macrophage Receptor With Collagenous Structure (MARCO) Antibody
20-abx131563	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Marco ORF Vector (Rat) (pORF)
ORF070301	ABM	1.0 ug DNA	EUR 506

MARCO ORF Vector (Human) (pORF)
ORF006281	ABM	1.0 ug DNA	EUR 95

Marco ORF Vector (Mouse) (pORF)
ORF049829	ABM	1.0 ug DNA	EUR 506

Macrophage Receptor With Collagenous Structure (MARCO) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAC614Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MARCO (Gly367~Arg519) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Macrophage Receptor With Collagenous Structure (MARCO). This antibody is labeled with APC-Cy7.

Marco sgRNA CRISPR Lentivector set (Rat)
K6667901	ABM	3 x 1.0 ug	EUR 339

Marco sgRNA CRISPR Lentivector set (Mouse)
K3658301	ABM	3 x 1.0 ug	EUR 339

MARCO sgRNA CRISPR Lentivector set (Human)
K1270701	ABM	3 x 1.0 ug	EUR 339

Marco sgRNA CRISPR Lentivector (Rat) (Target 1)
K6667902	ABM	1.0 ug DNA	EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 2)
K6667903	ABM	1.0 ug DNA	EUR 154

Marco sgRNA CRISPR Lentivector (Rat) (Target 3)
K6667904	ABM	1.0 ug DNA	EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3658302	ABM	1.0 ug DNA	EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3658303	ABM	1.0 ug DNA	EUR 154

Marco sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3658304	ABM	1.0 ug DNA	EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 1)
K1270702	ABM	1.0 ug DNA	EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 2)
K1270703	ABM	1.0 ug DNA	EUR 154

MARCO sgRNA CRISPR Lentivector (Human) (Target 3)
K1270704	ABM	1.0 ug DNA	EUR 154

MARCO Protein Vector (Human) (pPB-C-His)
PV025121	ABM	500 ng	EUR 329

MARCO Protein Vector (Human) (pPB-N-His)
PV025122	ABM	500 ng	EUR 329

MARCO Protein Vector (Human) (pPM-C-HA)
PV025123	ABM	500 ng	EUR 329

MARCO Protein Vector (Human) (pPM-C-His)
PV025124	ABM	500 ng	EUR 329

MARCO Protein Vector (Rat) (pPB-C-His)
PV281202	ABM	500 ng	EUR 603

MARCO Protein Vector (Rat) (pPB-N-His)
PV281203	ABM	500 ng	EUR 603

MARCO Protein Vector (Rat) (pPM-C-HA)
PV281204	ABM	500 ng	EUR 603

MARCO Protein Vector (Rat) (pPM-C-His)
PV281205	ABM	500 ng	EUR 603

MARCO Protein Vector (Mouse) (pPB-C-His)
PV199314	ABM	500 ng	EUR 603

MARCO Protein Vector (Mouse) (pPB-N-His)
PV199315	ABM	500 ng	EUR 603

MARCO Protein Vector (Mouse) (pPM-C-HA)
PV199316	ABM	500 ng	EUR 603

MARCO Protein Vector (Mouse) (pPM-C-His)
PV199317	ABM	500 ng	EUR 603

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)
4-RPC614Mu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q60754 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.0kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Macrophage Receptor With Collagenous Structure expressed in: E.coli

Recombinant Macrophage Receptor With Collagenous Structure (MARCO)
4-RPC614Ra01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: M0R9F7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.6kDa Isoelectric Point: Inquire
Description: Recombinant Rat Macrophage Receptor With Collagenous Structure expressed in: E.coli

Marco 3'UTR Luciferase Stable Cell Line
TU112920	ABM	1.0 ml	Ask for price

Marco 3'UTR GFP Stable Cell Line
TU162920	ABM	1.0 ml	Ask for price

Marco 3'UTR Luciferase Stable Cell Line
TU212886	ABM	1.0 ml	Ask for price

Marco 3'UTR GFP Stable Cell Line
TU262886	ABM	1.0 ml	Ask for price

MARCO 3'UTR GFP Stable Cell Line
TU063026	ABM	1.0 ml	EUR 1394

MARCO 3'UTR Luciferase Stable Cell Line
TU013026	ABM	1.0 ml	EUR 1394

Mouse Macrophage Receptor With Collagenous Structure (MARCO) Protein
20-abx650074	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Macrophage Receptor With Collagenous Structure (MARCO) Protein
20-abx650075	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

MARCO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV622369	ABM	1.0 ug DNA	EUR 682

MARCO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV622373	ABM	1.0 ug DNA	EUR 682

MARCO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV622374	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

MARCO Rabbit Polyclonal Antibody