MAL Rabbit Polyclonal Antibody

MAL Rabbit Polyclonal Antibody

 

MAL Polyclonal Antibody

ABP59210-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MAL protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MAL from Human, Mouse, Rat. This MAL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MAL protein at amino acid sequence of 70-150

MAL Polyclonal Antibody

ES9835-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MAL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAL Polyclonal Antibody

ES9835-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MAL from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAL Antibody

37714-100ul 100ul
EUR 252

MAL Antibody

1-CSB-PA913398
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAL. Recognizes MAL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MAL Antibody

DF9645 200ul
EUR 304
Description: MAL Antibody detects endogenous levels of total MAL.

MAL Antibody

1-CSB-PA013372LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAL Antibody

ABD9645 100 ug
EUR 438

Mal-PEG-Mal

abx085029-06kDa1g 0.6 kDa; 1 g
EUR 481
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-08kDa1g 0.8 kDa; 1 g
EUR 509
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-1kDa1g 1 kDa; 1 g
EUR 537
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-2kDa5g 2 kDa; 5 g
EUR 565
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-34kDa5g 3.4 kDa; 5 g
EUR 565
  • Shipped within 5-10 working days.

MAL-PEG-MAL,10K

33-HO022022-10K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,1K

33-HO022022-1K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,20K

33-HO022022-20K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,2K

33-HO022022-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,3.4K

33-HO022022-3.4K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,5K

33-HO022022-5K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,600

33-HO022022-600
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,6K

33-HO022022-6K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,800

33-HO022022-800
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL Conjugated Antibody

C37714 100ul
EUR 397

Anti-MAL antibody

STJ190993 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MAL

Mal/ Rat Mal ELISA Kit

ELI-06313r 96 Tests
EUR 886

Polyclonal Goat Anti-TIRAP / Mal (Isoform b) Antibody

APG00333G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TIRAP / Mal (Isoform b) . This antibody is tested and proven to work in the following applications:

MAL Antibody, HRP conjugated

1-CSB-PA013372LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAL Antibody, FITC conjugated

1-CSB-PA013372LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAL Antibody, Biotin conjugated

1-CSB-PA013372LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mal (Isoform b) Antibody

abx430620-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

mPEG-Mal

abx085012-035kDa1g 0.35 kDa; 1 g
EUR 425
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-075kDa1g 0.75 kDa; 1 g
EUR 467
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-30kDa1g 30 kDa; 1 g
EUR 453
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-40kDa1g 40 kDa; 1 g
EUR 453
  • Shipped within 5-10 working days.

MAL siRNA

20-abx903119
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAL siRNA

20-abx923351
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAL siRNA

20-abx923352
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-MAL

PVT18304 2 ug
EUR 231

anti-MAL

YF-PA13045 50 ug
EUR 363
Description: Mouse polyclonal to MAL

MAL Blocking Peptide

DF9645-BP 1mg
EUR 195

Mal-PEG4-Acid

abx186637-1g 1 g
EUR 606
  • Shipped within 1-2 weeks.

Mal-PEG-OH

abx085062-10kDa1g 10 kDa; 1 g
EUR 676
  • Shipped within 5-10 working days.

Mal-PEG-OH

abx085062-20kDa1g 20 kDa; 1 g
EUR 676
  • Shipped within 5-10 working days.

Mal-PEG-OH

abx085062-34kDa1g 3.4 kDa; 1 g
EUR 495
  • Shipped within 5-10 working days.

Mal-PEG-OH

abx085062-5kDa1g 5 kDa; 1 g
EUR 495
  • Shipped within 5-10 working days.

Biotin-PEG-Mal

abx085073-10kDa1g 10 kDa; 1 g
EUR 954
  • Shipped within 5-10 working days.

Biotin-PEG-Mal

abx085073-1kDa1g 1 kDa; 1 g
EUR 913
  • Shipped within 5-10 working days.

Biotin-PEG-Mal

abx085073-34kDa1g 3.4 kDa; 1 g
EUR 1163
  • Shipped within 5-10 working days.

Biotin-PEG-Mal

abx085073-5kDa1g 5 kDa; 1 g
EUR 1163
  • Shipped within 5-10 working days.

Alkyne-PEG-Mal

abx085163-10kDa1g 10 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

Alkyne-PEG-Mal

abx085163-20kDa1g 20 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

Alkyne-PEG-Mal

abx085163-2kDa1g 2 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

Alkyne-PEG-Mal

abx085163-5kDa1g 5 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

Br-PEG-Mal

abx085167-10kDa1g 10 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

Br-PEG-Mal

abx085167-1kDa1g 1 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

Br-PEG-Mal

abx085167-20kDa1g 20 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

DMPE-PEG-Mal

abx085194-2kDa1g 2 kDa; 1 g
EUR 1274
  • Shipped within 5-10 working days.

DMPE-PEG-Mal

abx085194-2kDa500mg 2 kDa; 500 mg
EUR 871
  • Shipped within 5-10 working days.

DMPE-PEG-Mal

abx085194-34kDa1g 3.4 kDa; 1 g
EUR 1274
  • Shipped within 5-10 working days.

DMPE-PEG-Mal

abx085194-34kDa500mg 3.4 kDa; 500 mg
EUR 871
  • Shipped within 5-10 working days.

DLPE-PEG-Mal

abx085198-2kDa500mg 2 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

DLPE-PEG-Mal

abx085198-34kDa1g 3.4 kDa; 1 g
EUR 1274
  • Shipped within 5-10 working days.

DLPE-PEG-Mal

abx085198-34kDa500mg 3.4 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

DLPE-PEG-Mal

abx085198-5kDa500mg 5 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

DPPE-PEG-Mal

abx085201-2kDa500mg 2 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

DPPE-PEG-Mal

abx085201-34kDa1g 3.4 kDa; 1 g
EUR 1274
  • Shipped within 5-10 working days.

DPPE-PEG-Mal

abx085201-34kDa500mg 3.4 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

DPPE-PEG-Mal

abx085201-5kDa500mg 5 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

Mal-PEG-SH

abx085215-10kDa1g 10 kDa; 1 g
EUR 857
  • Shipped within 5-10 working days.

Mal-PEG-SH

abx085215-1kDa1g 1 kDa; 1 g
EUR 829
  • Shipped within 5-10 working days.

Mal-PEG-SH

abx085215-2kDa1g 2 kDa; 1 g
EUR 1052
  • Shipped within 5-10 working days.

Mal-PEG-SH

abx085215-5kDa1g 5 kDa; 1 g
EUR 1052
  • Shipped within 5-10 working days.

DBCO-PEG-Mal

abx085227-10kDa100mg 10 kDa; 100 mg
EUR 1066
  • Shipped within 5-10 working days.

DBCO-PEG-Mal

abx085227-1kDa100mg 1 kDa; 100 mg
EUR 1052
  • Shipped within 5-10 working days.

DBCO-PEG-Mal

abx085227-34kDa100mg 3.4 kDa; 100 mg
EUR 1066
  • Shipped within 5-10 working days.

DBCO-PEG-Mal

abx085227-5kDa100mg 5 kDa; 100 mg
EUR 1066
  • Shipped within 5-10 working days.

Iodoacetate-PEG-Mal

abx085237-2kDa1g 2 kDa; 1 g
EUR 773
  • Shipped within 5-10 working days.

Iodoacetate-PEG-Mal

abx085237-34kDa1g 3.4 kDa; 1 g
EUR 773
  • Shipped within 5-10 working days.

Iodoacetate-PEG-Mal

abx085237-34kDa5g 3.4 kDa; 5 g
EUR 1970
  • Shipped within 5-10 working days.

Iodoacetate-PEG-Mal

abx085237-5kDa1g 5 kDa; 1 g
EUR 773
  • Shipped within 5-10 working days.

Silane-PEG-Mal

abx085246-10kDa1g 10 kDa; 1 g
EUR 801
  • Shipped within 5-10 working days.

Silane-PEG-Mal

abx085246-2kDa1g 2 kDa; 1 g
EUR 801
  • Shipped within 5-10 working days.

Silane-PEG-Mal

abx085246-5kDa5g 5 kDa; 5 g
EUR 2054
  • Shipped within 5-10 working days.

AC-PEG-Mal

abx085259-10kDa1g 10 kDa; 1 g
EUR 634
  • Shipped within 5-10 working days.

AC-PEG-Mal

abx085259-20kDa1g 20 kDa; 1 g
EUR 634
  • Shipped within 5-10 working days.

AC-PEG-Mal

abx085259-2kDa1g 2 kDa; 1 g
EUR 634
  • Shipped within 5-10 working days.

AC-PEG-Mal

abx085259-5kDa1g 5 kDa; 1 g
EUR 634
  • Shipped within 5-10 working days.

MA-PEG-Mal

abx085277-10kDa1g 10 kDa; 1 g
EUR 718
  • Shipped within 5-10 working days.

MA-PEG-Mal

abx085277-20kDa1g 20 kDa; 1 g
EUR 718
  • Shipped within 5-10 working days.

MA-PEG-Mal

abx085277-2kDa1g 2 kDa; 1 g
EUR 718
  • Shipped within 5-10 working days.

MA-PEG-Mal

abx085277-5kDa1g 5 kDa; 1 g
EUR 718
  • Shipped within 5-10 working days.

N3-PEG-Mal

abx085282-10kDa1g 10 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

N3-PEG-Mal

abx085282-20kDa1g 20 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

N3-PEG-Mal

abx085282-34kDa1g 3.4 kDa; 1 g
EUR 829
  • Shipped within 5-10 working days.

N3-PEG-Mal

abx085282-5kDa1g 5 kDa; 1 g
EUR 829
  • Shipped within 5-10 working days.

CHO-PEG-Mal

abx085291-10kDa5g 10 kDa; 5 g
EUR 2291
  • Shipped within 5-10 working days.

CHO-PEG-Mal

abx085291-20kDa1g 20 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

CHO-PEG-Mal

abx085291-2kDa1g 2 kDa; 1 g
EUR 871
  • Shipped within 5-10 working days.

FITC-PEG-Mal

abx085300-10kDa100mg 10 kDa; 100 mg
EUR 676
  • Shipped within 5-10 working days.

FITC-PEG-Mal

abx085300-34kDa100mg 3.4 kDa; 100 mg
EUR 648
  • Shipped within 5-10 working days.

FITC-PEG-Mal

abx085300-5kDa100mg 5 kDa; 100 mg
EUR 648
  • Shipped within 5-10 working days.

RB-PEG-Mal

abx085310-10kDa50mg 10 kDa; 50 mg
EUR 718
  • Shipped within 5-10 working days.

RB-PEG-Mal

abx085310-20kDa50mg 20 kDa; 50 mg
EUR 718
  • Shipped within 5-10 working days.

RB-PEG-Mal

abx085310-2kDa50mg 2 kDa; 50 mg
EUR 690
  • Shipped within 5-10 working days.

RB-PEG-Mal

abx085310-34kDa50mg 3.4 kDa; 50 mg
EUR 690
  • Shipped within 5-10 working days.

RB-PEG-Mal

abx085310-5kDa50mg 5 kDa; 50 mg
EUR 690
  • Shipped within 5-10 working days.

Cy3.5-PEG-Mal

abx085322-10kDa500mg 10 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

Cy3.5-PEG-Mal

abx085322-2kDa500mg 2 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

Cy3.5-PEG-Mal

abx085322-34kDa500mg 3.4 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

Cy3.5-PEG-Mal

abx085322-5kDa500mg 5 kDa; 500 mg
EUR 801
  • Shipped within 5-10 working days.

Mal-PEG-NHS

abx085346-08kDa1g 0.8 kDa; 1 g
EUR 954
  • Shipped within 5-10 working days.

Mal-PEG-NHS

abx085346-10kDa1g 10 kDa; 1 g
EUR 1080
  • Shipped within 5-10 working days.

Mal-PEG-NHS

abx085346-1kDa1g 1 kDa; 1 g
EUR 1066
  • Shipped within 5-10 working days.

Mal-PEG-NHS

abx085346-20kDa1g 20 kDa; 1 g
EUR 1080
  • Shipped within 5-10 working days.

Mal-PEG-NHS

abx085346-2kDa1g 2 kDa; 1 g
EUR 1274
  • Shipped within 5-10 working days.

Mal-PEG-HZ

abx085354-10kDa1g 10 kDa; 1 g
EUR 428
  • Shipped within 5-10 working days.

Mal-PEG-HZ

abx085354-1kDa1g 1 kDa; 1 g
EUR 428
  • Shipped within 5-10 working days.

Mal-PEG-HZ

abx085354-2kDa1g 2 kDa; 1 g
EUR 458
  • Shipped within 5-10 working days.

Mal-PEG-HZ

abx085354-5kDa1g 5 kDa; 1 g
EUR 458
  • Shipped within 5-10 working days.

Cy5-PEG-Mal

abx085358-10kDa50mg 10 kDa; 50 mg
EUR 546
  • Shipped within 5-10 working days.

Cy5-PEG-Mal

abx085358-1kDa50mg 1 kDa; 50 mg
EUR 546
  • Shipped within 5-10 working days.

Cy5-PEG-Mal

abx085358-2kDa50mg 2 kDa; 50 mg
EUR 570
  • Shipped within 5-10 working days.

Mal-PEG-SVA

abx085360-10kDa1g 10 kDa; 1 g
EUR 617
  • Shipped within 5-10 working days.

Mal-PEG-SVA

abx085360-20kDa1g 20 kDa; 1 g
EUR 617
  • Shipped within 5-10 working days.

Mal-PEG-SVA

abx085360-2kDa1g 2 kDa; 1 g
EUR 653
  • Shipped within 5-10 working days.

Mal-PEG-SVA

abx085360-5kDa1g 5 kDa; 1 g
EUR 653
  • Shipped within 5-10 working days.

CLS-PEG-Mal

abx085370-2kDa100mg 2 kDa; 100 mg
EUR 333
  • Shipped within 5-10 working days.

CLS-PEG-Mal

abx085370-34kDa100mg 3.4 kDa; 100 mg
EUR 333
  • Shipped within 5-10 working days.

CLS-PEG-Mal

abx085370-5kDa100mg 5 kDa; 100 mg
EUR 343
  • Shipped within 5-10 working days.

FA-PEG-Mal

abx085379-34kDa100mg 3.4 kDa; 100 mg
EUR 428
  • Shipped within 5-10 working days.

FA-PEG-Mal

abx085379-5kDa100mg 5 kDa; 100 mg
EUR 441
  • Shipped within 5-10 working days.

OPSS-PEG-Mal

abx085383-2kDa1g 2 kDa; 1 g
EUR 570
  • Shipped within 5-10 working days.

OPSS-PEG-Mal

abx085383-5kDa1g 5 kDa; 1 g
EUR 588
  • Shipped within 5-10 working days.

Mal-PEG2-COOH

20-abx085431
  • EUR 1776.00
  • EUR 1177.00
  • 1 g
  • 500 mg
  • Shipped within 1-2 weeks.

Mal-PEG4-NHS

20-abx085432
  • EUR 537.00
  • EUR 1233.00
  • 100 mg
  • 500 mg
  • Shipped within 1-2 weeks.

MAL-HA-Osu

ADC-L-021 unit Ask for price

Mal-PEG4-NHS

ADC-L-078 unit Ask for price

Mal-PEG-NHS

ADC-L-080 unit Ask for price

Mal-PEG10-NHS

ADC-L-083 unit Ask for price

Mal-PEG5-NHS

ADC-L-145 unit Ask for price

Mal-PEG10-NHS

ADC-L-148 unit Ask for price

MAL cloning plasmid

CSB-CL013372HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtc
  • Show more
Description: A cloning plasmid for the MAL gene.

Mal-PEG-OH

33-HE022002-1K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,10K

33-HE022005-10K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,1K

33-HE022005-1K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,20K

33-HE022005-20K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,2K

33-HE022005-2K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,3.4K

33-HE022005-3.4K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,300

33-HE022005-300
  • EUR 519.00
  • EUR 1456.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,400

33-HE022005-400
  • EUR 519.00
  • EUR 1456.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,4K

33-HE022005-4K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,500

33-HE022005-500
  • EUR 519.00
  • EUR 1456.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,5K

33-HE022005-5K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,600

33-HE022005-600
  • EUR 519.00
  • EUR 1456.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,6K

33-HE022005-6K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,7.5K

33-HE022005-7.5K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,800

33-HE022005-800
  • EUR 519.00
  • EUR 1456.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-MAL

HE057022-2K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-MAL

HE057022-3.4K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-MAL

HE057022-5K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,10K

33-MF001022-10K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,1K

33-MF001022-1K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,20K

33-MF001022-20K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,2K

33-MF001022-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,30K

33-MF001022-30K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,350

33-MF001022-350
  • EUR 248.00
  • EUR 642.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,40K

33-MF001022-40K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,4K

33-MF001022-4K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,500

33-MF001022-500
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,550

33-MF001022-550
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL Rabbit Polyclonal Antibody