LRP12 Rabbit Polyclonal Antibody
LRP12 Polyclonal Antibody |
ABP59144-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of LRP12 from Human. This LRP12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170 |
LRP12 Polyclonal Antibody |
ABP59144-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of LRP12 from Human. This LRP12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170 |
LRP12 Rabbit pAb |
A6275-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP12 Rabbit pAb |
A6275-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP12 Rabbit pAb |
A6275-20ul |
Abclonal |
20 ul |
Ask for price |
LRP12 Rabbit pAb |
A6275-50ul |
Abclonal |
50 ul |
Ask for price |
LRP12 antibody |
70R-50967 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal LRP12 antibody |
LRP12 Antibody |
35802-100ul |
SAB |
100ul |
EUR 252 |
LRP12 antibody |
23126-100ul |
SAB |
100ul |
EUR 390 |
LRP12 antibody |
70R-13204 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal LRP12 antibody |
LRP12 Antibody |
DF9608 |
Affbiotech |
200ul |
EUR 304 |
Description: LRP12 Antibody detects endogenous levels of total LRP12. |
LRP12 Antibody |
1-CSB-PA978774 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LRP12. Recognizes LRP12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100 |
LRP12 Antibody |
1-CSB-PA222144 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LRP12. Recognizes LRP12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
Polyclonal LRP12 Antibody (C-term) |
APR03614G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP12 (C-term). This antibody is tested and proven to work in the following applications: |
LRP12 Conjugated Antibody |
C35802 |
SAB |
100ul |
EUR 397 |
Anti-LRP12 antibody |
STJ28197 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. |
Anti-LRP12 antibody |
STJ190934 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LRP12 |
LRP12 siRNA |
20-abx922838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP12 siRNA |
20-abx922839 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP12 Blocking Peptide |
20-abx063842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP12 Blocking Peptide |
DF9608-BP |
Affbiotech |
1mg |
EUR 195 |
LRP12 cloning plasmid |
CSB-CL896728HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 390
- Sequence: atgaagatattctactatgcattaaatcttgaactttataaaacatgtacaaaaattgtacaagataagttccacctggtaatgtctttccctaatacagggttgcgcttgcattggaccctagggatttgcactaaaattatatcaaggtctcagatgagcttagtgcacaagca
- Show more
|
Description: A cloning plasmid for the LRP12 gene. |
LRP12 cloning plasmid |
CSB-CL896728HU2-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2580
- Sequence: atggcctgtcgctggagcacaaaagagtctccgcggtggaggtctgcgttgctcttgcttttcctcgctggggtgtacggaaatggtgctcttgcagaacattctgaaaatgtgcatatttcaggagtgtcaactgcttgtggagagactccagagcaaatacgagcaccaagtg
- Show more
|
Description: A cloning plasmid for the LRP12 gene. |
Human LRP12 shRNA Plasmid |
20-abx959305 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse LRP12 shRNA Plasmid |
20-abx982385 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LDL Receptor Related Protein 12 (LRP12) Antibody |
abx036738-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
LDL Receptor Related Protein 12 (LRP12) Antibody |
20-abx008171 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
LDL Receptor Related Protein 12 (LRP12) Antibody |
abx026425-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
LDL Receptor Related Protein 12 (LRP12) Antibody |
abx026425-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
LDL Receptor Related Protein 12 (LRP12) Antibody |
20-abx212164 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LDL Receptor Related Protein 12 (LRP12) Antibody |
20-abx212278 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP12 ORF Vector (Human) (pORF) |
ORF006067 |
ABM |
1.0 ug DNA |
EUR 95 |
LRP12 ORF Vector (Human) (pORF) |
ORF006068 |
ABM |
1.0 ug DNA |
EUR 95 |
Lrp12 ORF Vector (Mouse) (pORF) |
ORF049369 |
ABM |
1.0 ug DNA |
EUR 506 |
Lrp12 ORF Vector (Rat) (pORF) |
ORF069974 |
ABM |
1.0 ug DNA |
EUR 506 |
LRP12 sgRNA CRISPR Lentivector set (Human) |
K1231001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lrp12 sgRNA CRISPR Lentivector set (Mouse) |
K3671301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lrp12 sgRNA CRISPR Lentivector set (Rat) |
K7593901 |
ABM |
3 x 1.0 ug |
EUR 339 |
LRP12 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1231002 |
ABM |
1.0 ug DNA |
EUR 154 |
LRP12 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1231003 |
ABM |
1.0 ug DNA |
EUR 154 |
LRP12 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1231004 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrp12 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3671302 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrp12 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3671303 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrp12 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3671304 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrp12 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7593902 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrp12 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7593903 |
ABM |
1.0 ug DNA |
EUR 154 |
Lrp12 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7593904 |
ABM |
1.0 ug DNA |
EUR 154 |
LRP12 Protein Vector (Human) (pPB-C-His) |
PV024265 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPB-N-His) |
PV024266 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPM-C-HA) |
PV024267 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPM-C-His) |
PV024268 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPB-C-His) |
PV024269 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPB-N-His) |
PV024270 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPM-C-HA) |
PV024271 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Human) (pPM-C-His) |
PV024272 |
ABM |
500 ng |
EUR 329 |
LRP12 Protein Vector (Rat) (pPB-C-His) |
PV279894 |
ABM |
500 ng |
EUR 1191 |
LRP12 Protein Vector (Rat) (pPB-N-His) |
PV279895 |
ABM |
500 ng |
EUR 1191 |
LRP12 Protein Vector (Rat) (pPM-C-HA) |
PV279896 |
ABM |
500 ng |
EUR 1191 |
LRP12 Protein Vector (Rat) (pPM-C-His) |
PV279897 |
ABM |
500 ng |
EUR 1191 |
LRP12 Protein Vector (Mouse) (pPB-C-His) |
PV197474 |
ABM |
500 ng |
EUR 1065 |
LRP12 Protein Vector (Mouse) (pPB-N-His) |
PV197475 |
ABM |
500 ng |
EUR 1065 |
LRP12 Protein Vector (Mouse) (pPM-C-HA) |
PV197476 |
ABM |
500 ng |
EUR 1065 |
LRP12 Protein Vector (Mouse) (pPM-C-His) |
PV197477 |
ABM |
500 ng |
EUR 1065 |
Lrp12 3'UTR GFP Stable Cell Line |
TU162574 |
ABM |
1.0 ml |
Ask for price |
Lrp12 3'UTR Luciferase Stable Cell Line |
TU212535 |
ABM |
1.0 ml |
Ask for price |
LRP12 3'UTR Luciferase Stable Cell Line |
TU012625 |
ABM |
1.0 ml |
EUR 1394 |
Lrp12 3'UTR Luciferase Stable Cell Line |
TU112574 |
ABM |
1.0 ml |
Ask for price |
LRP12 3'UTR GFP Stable Cell Line |
TU062625 |
ABM |
1.0 ml |
EUR 1394 |
Lrp12 3'UTR GFP Stable Cell Line |
TU262535 |
ABM |
1.0 ml |
Ask for price |
LRP12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV650965 |
ABM |
1.0 ug DNA |
EUR 1355 |
LRP12 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV650969 |
ABM |
1.0 ug DNA |
EUR 1355 |
LRP12 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV650970 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
LRP12 Rabbit Polyclonal Antibody