LRP12 Rabbit Polyclonal Antibody

LRP12 Rabbit Polyclonal Antibody

 

LRP12 Polyclonal Antibody

ABP59144-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of LRP12 from Human. This LRP12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170

LRP12 Polyclonal Antibody

ABP59144-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of LRP12 from Human. This LRP12 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP12 protein at amino acid sequence of 90-170

LRP12 Rabbit pAb

A6275-100ul 100 ul
EUR 308

LRP12 Rabbit pAb

A6275-200ul 200 ul
EUR 459

LRP12 Rabbit pAb

A6275-20ul 20 ul Ask for price

LRP12 Rabbit pAb

A6275-50ul 50 ul Ask for price

LRP12 Antibody

ABD9608 100 ug
EUR 438

LRP12 antibody

70R-50967 100 ul
EUR 244
Description: Purified Polyclonal LRP12 antibody

LRP12 Antibody

35802-100ul 100ul
EUR 252

LRP12 antibody

23126-100ul 100ul
EUR 390

LRP12 antibody

70R-13204 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal LRP12 antibody

LRP12 Antibody

DF9608 200ul
EUR 304
Description: LRP12 Antibody detects endogenous levels of total LRP12.

LRP12 Antibody

1-CSB-PA978774
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRP12. Recognizes LRP12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

LRP12 Antibody

1-CSB-PA222144
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRP12. Recognizes LRP12 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

Polyclonal LRP12 Antibody (C-term)

APR03614G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP12 (C-term). This antibody is tested and proven to work in the following applications:

LRP12 Conjugated Antibody

C35802 100ul
EUR 397

Anti-LRP12 antibody

STJ28197 100 µl
EUR 277
Description: This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants.

Anti-LRP12 antibody

STJ190934 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRP12

LRP12 siRNA

20-abx922838
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRP12 siRNA

20-abx922839
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LRP12 Blocking Peptide

20-abx063842
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

LRP12 Blocking Peptide

DF9608-BP 1mg
EUR 195

LRP12 cloning plasmid

CSB-CL896728HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 390
  • Sequence: atgaagatattctactatgcattaaatcttgaactttataaaacatgtacaaaaattgtacaagataagttccacctggtaatgtctttccctaatacagggttgcgcttgcattggaccctagggatttgcactaaaattatatcaaggtctcagatgagcttagtgcacaagca
  • Show more
Description: A cloning plasmid for the LRP12 gene.

LRP12 cloning plasmid

CSB-CL896728HU2-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2580
  • Sequence: atggcctgtcgctggagcacaaaagagtctccgcggtggaggtctgcgttgctcttgcttttcctcgctggggtgtacggaaatggtgctcttgcagaacattctgaaaatgtgcatatttcaggagtgtcaactgcttgtggagagactccagagcaaatacgagcaccaagtg
  • Show more
Description: A cloning plasmid for the LRP12 gene.

Human LRP12 ELISA KIT

ELI-27771h 96 Tests
EUR 824

Mouse Lrp12 ELISA KIT

ELI-31429m 96 Tests
EUR 865

Human LRP12 shRNA Plasmid

20-abx959305
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LRP12 shRNA Plasmid

20-abx982385
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LDL Receptor Related Protein 12 (LRP12) Antibody

abx036738-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

LDL Receptor Related Protein 12 (LRP12) Antibody

20-abx008171
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

LDL Receptor Related Protein 12 (LRP12) Antibody

abx026425-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

LDL Receptor Related Protein 12 (LRP12) Antibody

abx026425-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

LDL Receptor Related Protein 12 (LRP12) Antibody

20-abx212164
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LDL Receptor Related Protein 12 (LRP12) Antibody

20-abx212278
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

LRP12 ORF Vector (Human) (pORF)

ORF006067 1.0 ug DNA
EUR 95

LRP12 ORF Vector (Human) (pORF)

ORF006068 1.0 ug DNA
EUR 95

Lrp12 ORF Vector (Mouse) (pORF)

ORF049369 1.0 ug DNA
EUR 506

Lrp12 ORF Vector (Rat) (pORF)

ORF069974 1.0 ug DNA
EUR 506

LRP12 sgRNA CRISPR Lentivector set (Human)

K1231001 3 x 1.0 ug
EUR 339

Lrp12 sgRNA CRISPR Lentivector set (Mouse)

K3671301 3 x 1.0 ug
EUR 339

Lrp12 sgRNA CRISPR Lentivector set (Rat)

K7593901 3 x 1.0 ug
EUR 339

LRP12 sgRNA CRISPR Lentivector (Human) (Target 1)

K1231002 1.0 ug DNA
EUR 154

LRP12 sgRNA CRISPR Lentivector (Human) (Target 2)

K1231003 1.0 ug DNA
EUR 154

LRP12 sgRNA CRISPR Lentivector (Human) (Target 3)

K1231004 1.0 ug DNA
EUR 154

Lrp12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3671302 1.0 ug DNA
EUR 154

Lrp12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3671303 1.0 ug DNA
EUR 154

Lrp12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3671304 1.0 ug DNA
EUR 154

Lrp12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7593902 1.0 ug DNA
EUR 154

Lrp12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7593903 1.0 ug DNA
EUR 154

Lrp12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7593904 1.0 ug DNA
EUR 154

LRP12 Protein Vector (Human) (pPB-C-His)

PV024265 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPB-N-His)

PV024266 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPM-C-HA)

PV024267 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPM-C-His)

PV024268 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPB-C-His)

PV024269 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPB-N-His)

PV024270 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPM-C-HA)

PV024271 500 ng
EUR 329

LRP12 Protein Vector (Human) (pPM-C-His)

PV024272 500 ng
EUR 329

LRP12 Protein Vector (Rat) (pPB-C-His)

PV279894 500 ng
EUR 1191

LRP12 Protein Vector (Rat) (pPB-N-His)

PV279895 500 ng
EUR 1191

LRP12 Protein Vector (Rat) (pPM-C-HA)

PV279896 500 ng
EUR 1191

LRP12 Protein Vector (Rat) (pPM-C-His)

PV279897 500 ng
EUR 1191

LRP12 Protein Vector (Mouse) (pPB-C-His)

PV197474 500 ng
EUR 1065

LRP12 Protein Vector (Mouse) (pPB-N-His)

PV197475 500 ng
EUR 1065

LRP12 Protein Vector (Mouse) (pPM-C-HA)

PV197476 500 ng
EUR 1065

LRP12 Protein Vector (Mouse) (pPM-C-His)

PV197477 500 ng
EUR 1065

Lrp12 3'UTR GFP Stable Cell Line

TU162574 1.0 ml Ask for price

Lrp12 3'UTR Luciferase Stable Cell Line

TU212535 1.0 ml Ask for price

LRP12 3'UTR Luciferase Stable Cell Line

TU012625 1.0 ml
EUR 1394

Lrp12 3'UTR Luciferase Stable Cell Line

TU112574 1.0 ml Ask for price

LRP12 3'UTR GFP Stable Cell Line

TU062625 1.0 ml
EUR 1394

Lrp12 3'UTR GFP Stable Cell Line

TU262535 1.0 ml Ask for price

LRP12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650965 1.0 ug DNA
EUR 1355

LRP12 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650969 1.0 ug DNA
EUR 1355

LRP12 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650970 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LRP12 Rabbit Polyclonal Antibody