LDHC Rabbit Polyclonal Antibody

LDHC Rabbit Polyclonal Antibody


LDHC Polyclonal Antibody

ES9772-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDHC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LDHC Polyclonal Antibody

ES9772-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDHC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

EUR 517
  • Should the Human Lactate Dehydrogenase C (LDHC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase C (LDHC) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

EUR 673
  • Should the Human Lactate Dehydrogenase C (LDHC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase C (LDHC) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

RDR-LDHC-Hu-48Tests 48 Tests
EUR 544

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

RDR-LDHC-Hu-96Tests 96 Tests
EUR 756

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

RD-LDHC-Hu-48Tests 48 Tests
EUR 521

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

RD-LDHC-Hu-96Tests 96 Tests
EUR 723

LDHC Rabbit pAb

A15003-100ul 100 ul
EUR 308

LDHC Rabbit pAb

A15003-200ul 200 ul
EUR 459

LDHC Rabbit pAb

A15003-20ul 20 ul
EUR 183

LDHC Rabbit pAb

A15003-50ul 50 ul
EUR 223

LDHC antibody

70R-18239 50 ul
EUR 435
Description: Rabbit polyclonal LDHC antibody

LDHC antibody

70R-2542 50 ug
EUR 467
Description: Rabbit polyclonal LDHC antibody raised against the middle region of LDHC

LDHC Antibody

43519-100ul 100ul
EUR 252

LDHC Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LDHC. Recognizes LDHC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

LDHC Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHC. Recognizes LDHC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal LDHC antibody - middle region

APR08209G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDHC - middle region. This antibody is tested and proven to work in the following applications:

LDHC Conjugated Antibody

C43519 100ul
EUR 397

LDHC-Specific Antibody

abx234740-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-LDHC antibody

STJ117200 100 µl
EUR 277
Description: Lactate dehydrogenase C catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. LDHC is testis-specific and belongs to the lactate dehydrogenase family. Two transcript variants have been detected which differ in the 5' untranslated region.

Anti-LDHC antibody

STJ190930 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LDHC

Ldhc/ Rat Ldhc ELISA Kit

ELI-07050r 96 Tests
EUR 886

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LDHC Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHC. Recognizes LDHC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LDHC Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHC. Recognizes LDHC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LDHC Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHC. Recognizes LDHC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti- LDHC-Specific antibody

FNab04740 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: lactate dehydrogenase C
  • Uniprot ID: P07864
  • Research Area: Metabolism
Description: Antibody raised against LDHC-Specific

Anti-LDHC-Specific antibody

PAab04740 100 ug
EUR 412

Polyclonal Goat Anti-LDHC (aa 217 - 231) Antibody

AMM05034G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LDHC (aa 217 - 231) . This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-LDHC (aa 221 - 233) Antibody

AMM05045G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LDHC (aa 221 - 233) . This antibody is tested and proven to work in the following applications:

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with APC.

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with Biotin.

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with Cy3.

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with FITC.

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with HRP.

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with PE.

Rabbit Lactate Dehydrogenase C (LDHC) ELISA Kit

abx363338-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

LDHC Blocking Peptide

33R-4202 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDHC antibody, catalog no. 70R-2542

LDHC cloning plasmid

CSB-CL012844HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 999
  • Sequence: atgtcaactgtcaaggagcagctaattgagaagctaattgaggatgatgaaaactcccagtgtaaaattactattgttggaactggtgccgtaggcatggcttgtgctattagtatcttactgaaggatttggctgatgaacttgcccttgttgatgttgcattggacaaactgaa
  • Show more
Description: A cloning plasmid for the LDHC gene.

Lactate Dehydrogenase C (LDHC) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactate Dehydrogenase C (LDHC) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase C (LDHC) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactate Dehydrogenase C (LDHC) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactate Dehydrogenase C (LDHC) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactate Dehydrogenase C (LDHC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase C (LDHC) Antibody

abx431383-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Lactate Dehydrogenase C (LDHC) Antibody

abx431384-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Lactate Dehydrogenase C (LDHC) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHC (Met1~Leu332)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Lactate Dehydrogenase C (LDHC). This antibody is labeled with APC-Cy7.

Lactate Dehydrogenase C (LDHC) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase C (LDHC) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase C (LDHC) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LDHC (aa 217 - 231) antibody

STJ71275 100 µg
EUR 359

Anti-LDHC (aa 221 - 233) antibody

STJ71276 100 µg
EUR 359


ELA-E2198h 96 Tests
EUR 824


EF006231 96 Tests
EUR 689

Human LDHC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LDHC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6.1-LDHC Plasmid

PVT16933 2 ug
EUR 325

LDHC Recombinant Protein (Human)

RP017647 100 ug Ask for price

LDHC Recombinant Protein (Rat)

RP207956 100 ug Ask for price

LDHC Recombinant Protein (Mouse)

RP147161 100 ug Ask for price

Rabbit L lactate dehydrogenase C chain(LDHC) ELISA kit

E04L0325-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit L lactate dehydrogenase C chain(LDHC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L lactate dehydrogenase C chain(LDHC) ELISA kit

E04L0325-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit L lactate dehydrogenase C chain(LDHC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L lactate dehydrogenase C chain(LDHC) ELISA kit

E04L0325-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit L lactate dehydrogenase C chain(LDHC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ldhc ORF Vector (Rat) (pORF)

ORF069320 1.0 ug DNA
EUR 506

LDHC ORF Vector (Human) (pORF)

ORF005883 1.0 ug DNA
EUR 95

Ldhc ORF Vector (Mouse) (pORF)

ORF049055 1.0 ug DNA
EUR 506

Recombinant Lactate Dehydrogenase C (LDHC)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19629
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.5kDa
  • Isoelectric Point: 8.1
Description: Recombinant Rat Lactate Dehydrogenase C expressed in: E.coli

LDHC ELISA Kit (Human) (OKCD02684)

OKCD02684 96 Wells
EUR 831
Description: Description of target: Possible role in sperm motility. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.54 ng/mL

LDHC ELISA Kit (Human) (OKCA02119)

OKCA02119 96 Wells
EUR 833
Description: Description of target: Possible role in sperm motility. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 mU/mL

LDHC ELISA Kit (Rat) (OKCD08604)

OKCD08604 96 Wells
EUR 1053
Description: Description of target: member of the lactate dehydrogenase family, which catalyzes the conversion of lactate to pyruvate;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 1.26ng/mL

LDHC ELISA Kit (Human) (OKEH07036)

OKEH07036 96 Wells
EUR 662
Description: Description of target: Possible role in sperm motility. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39U/L

LDHC ELISA Kit (Mouse) (OKEH05216)

OKEH05216 96 Wells
EUR 662
Description: Description of target: Possible role in sperm motility.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.787 ng/mL

LDHC ELISA Kit (Rat) (OKEH01557)

OKEH01557 96 Wells
EUR 662
Description: Description of target: member of the lactate dehydrogenase family, which catalyzes the conversion of lactate to pyruvate;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.788 ng/mL

Rat Lactate Dehydrogenase C (LDHC) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Lactate Dehydrogenase C (LDHC) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ldhc sgRNA CRISPR Lentivector set (Mouse)

K4868201 3 x 1.0 ug
EUR 339

Ldhc sgRNA CRISPR Lentivector set (Rat)

K6779501 3 x 1.0 ug
EUR 339

LDHC sgRNA CRISPR Lentivector set (Human)

K1205701 3 x 1.0 ug
EUR 339

Human L-lactate dehydrogenase C chain (LDHC)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human L-lactate dehydrogenase C chain(LDHC) expressed in E.coli

Human Lactate Dehydrogenase C (LDHC) CLIA Kit

abx195963-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Lactate Dehydrogenase C (LDHC) ELISA Kit

abx256623-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Lactate Dehydrogenase C (LDHC) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

abx251493-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Lactate Dehydrogenase C (LDHC) ELISA Kit

abx359647-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Pig Lactate Dehydrogenase C (LDHC) ELISA Kit

abx361440-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Lactate Dehydrogenase C (LDHC) ELISA Kit

abx356868-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase C (LDHC) ELISA Kit

abx573952-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Lactate Dehydrogenase C (LDHC) ELISA Kit

abx519710-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Lactate Dehydrogenase C (LDHC) ELISA Kit

abx519711-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Rat Lactate Dehydrogenase C (LDHC) ELISA Kit

abx519712-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase C (LDHC) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Lactate Dehydrogenase C (LDHC) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human L-lactate dehydrogenase C chain (LDHC)

  • EUR 661.00
  • EUR 276.00
  • EUR 1669.00
  • EUR 885.00
  • EUR 1221.00
  • EUR 381.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human L-lactate dehydrogenase C chain (LDHC) ,partial expressed in Baculovirus

Ldhc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4868202 1.0 ug DNA
EUR 154

Ldhc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4868203 1.0 ug DNA
EUR 154

Ldhc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4868204 1.0 ug DNA
EUR 154

Ldhc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6779502 1.0 ug DNA
EUR 154

Ldhc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6779503 1.0 ug DNA
EUR 154

Ldhc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6779504 1.0 ug DNA
EUR 154

LDHC sgRNA CRISPR Lentivector (Human) (Target 1)

K1205702 1.0 ug DNA
EUR 154

LDHC sgRNA CRISPR Lentivector (Human) (Target 2)

K1205703 1.0 ug DNA
EUR 154

LDHC sgRNA CRISPR Lentivector (Human) (Target 3)

K1205704 1.0 ug DNA
EUR 154

LDHC Rabbit Polyclonal Antibody