LARP1 Rabbit Polyclonal Antibody

LARP1 Rabbit Polyclonal Antibody


LARP1 Polyclonal Antibody

ES9762-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LARP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LARP1 Polyclonal Antibody

ES9762-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LARP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LARP1 Rabbit pAb

A4543-100ul 100 ul
EUR 308

LARP1 Rabbit pAb

A4543-200ul 200 ul
EUR 459

LARP1 Rabbit pAb

A4543-20ul 20 ul
EUR 183

LARP1 Rabbit pAb

A4543-50ul 50 ul
EUR 223

LARP1 Polyclonal Conjugated Antibody

C30580 100ul
EUR 397

LARP1 antibody

70R-18213 50 ul
EUR 435
Description: Rabbit polyclonal LARP1 antibody

LARP1 antibody

70R-4916 50 ug
EUR 467
Description: Rabbit polyclonal LARP1 antibody raised against the N terminal of LARP1

LARP1 antibody

70R-4917 50 ug
EUR 467
Description: Rabbit polyclonal LARP1 antibody raised against the N terminal of LARP1

LARP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LARP1. Recognizes LARP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- LARP1 antibody

FNab04698 100µg
EUR 548.75
  • Immunogen: La ribonucleoprotein domain family, member 1
  • Uniprot ID: Q6PKG0
  • Gene ID: 23367
  • Research Area: Metabolism
Description: Antibody raised against LARP1

Anti-LARP1 antibody

PAab04698 100 ug
EUR 386

Anti-LARP1 antibody

STJ111225 100 µl
EUR 277

Anti-LARP1 antibody

STJ190920 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LARP1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18671 2 ug
EUR 300


YF-PA17854 50 ug
EUR 363
Description: Mouse polyclonal to LARP1

LARP1 Blocking Peptide

33R-3771 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARP1 antibody, catalog no. 70R-4917

LARP1 Blocking Peptide

33R-4387 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARP1 antibody, catalog no. 70R-4916

LARP1 cloning plasmid

CSB-CL740795HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 162
  • Sequence: atgttaggagttaatgttgcaaagagtagtttacatcttcactttctgaagacacttgaatttaggaccgatgtatctgtgacaagcatgccagaagtggcaggggccatcagggctaaccacttcacacctaccatcgtcccatggggatccaagacctga
Description: A cloning plasmid for the LARP1 gene.

LARP1 cloning plasmid

CSB-CL740795HU2-10ug 10ug
EUR 1130
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3060
  • Sequence: atgctttggagggtgcttttgtcaaagaggcctcctttccctcacccagagctggatttccaagaggctcccatacctagctgccctggcagactcccagggaggaaaaacagcgtggccttggcagctgccccgaggaaggagcccacaggtgacagggagaagccattgccat
  • Show more
Description: A cloning plasmid for the LARP1 gene.

LARP1 cloning plasmid

CSB-CL740795HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgcctcgaaaaagaaagacaagacacagttcaaacccacccttggagagccatgtgggctgggtgatggattcccgtgagcacaggccccgtactgcttccatcagctccagcccctcagaagggacgcctacagttggcagctatggctgtacccctcagtcattgcccaagtt
  • Show more
Description: A cloning plasmid for the LARP1 gene.


EF010621 96 Tests
EUR 689

Mouse LARP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LARP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

La-Related Protein 1 (LARP1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

La-Related Protein 1 (LARP1) Antibody

abx036092-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

La-Related Protein 1 (LARP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

La-Related Protein 1 (LARP1) Antibody

abx234698-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

LARP1 ORF Vector (Human) (pORF)

ORF005838 1.0 ug DNA
EUR 95

LARP1 ORF Vector (Human) (pORF)

ORF005839 1.0 ug DNA
EUR 95

LARP1 ORF Vector (Human) (pORF)

ORF005840 1.0 ug DNA
EUR 95

Larp1 ORF Vector (Mouse) (pORF)

ORF048957 1.0 ug DNA
EUR 506

LARP1 ELISA Kit (Human) (OKCA01324)

OKCA01324 96 Wells
EUR 846
Description: Description of target: RNA-binding protein that promotes translation of specific classes of mRNAs downstream of the mTORC1 complex. Associates with the mRNA 5'cap in an MTOR-dependent manner and associates with mRNAs containing a 5' terminal oligopyrimidine (5'TOP) motif, which is present in mRNAs encoding for ribosomal proteins and several components of the translation machinery. Associates with actively translating ribosomes via interaction with PABPC1/PABP and stimulates translation of mRNAs containing a 5'TOP, thereby regulating cell growth and proliferation. Positively regulates the replication of dengue virus (DENV) (PubMed:26735137).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL

Larp1 sgRNA CRISPR Lentivector set (Mouse)

K4651901 3 x 1.0 ug
EUR 339

LARP1 sgRNA CRISPR Lentivector set (Human)

K1196301 3 x 1.0 ug
EUR 339

Larp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4651902 1.0 ug DNA
EUR 154

Larp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4651903 1.0 ug DNA
EUR 154

Larp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4651904 1.0 ug DNA
EUR 154

LARP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1196302 1.0 ug DNA
EUR 154

LARP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1196303 1.0 ug DNA
EUR 154

LARP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1196304 1.0 ug DNA
EUR 154

LARP1 Protein Vector (Human) (pPB-C-His)

PV023349 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPB-N-His)

PV023350 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPM-C-HA)

PV023351 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPM-C-His)

PV023352 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPB-C-His)

PV023353 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPB-N-His)

PV023354 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPM-C-HA)

PV023355 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPM-C-His)

PV023356 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPB-C-His)

PV023357 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPB-N-His)

PV023358 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPM-C-HA)

PV023359 500 ng
EUR 329

LARP1 Protein Vector (Human) (pPM-C-His)

PV023360 500 ng
EUR 329

LARP1 Protein Vector (Mouse) (pPB-C-His)

PV195826 500 ng
EUR 1065

LARP1 Protein Vector (Mouse) (pPB-N-His)

PV195827 500 ng
EUR 1065

LARP1 Protein Vector (Mouse) (pPM-C-HA)

PV195828 500 ng
EUR 1065

LARP1 Protein Vector (Mouse) (pPM-C-His)

PV195829 500 ng
EUR 1065

Larp1 3'UTR Luciferase Stable Cell Line

TU110901 1.0 ml Ask for price

Larp1 3'UTR GFP Stable Cell Line

TU160901 1.0 ml Ask for price

Larp1 3'UTR Luciferase Stable Cell Line

TU206946 1.0 ml Ask for price

Larp1 3'UTR GFP Stable Cell Line

TU256946 1.0 ml Ask for price

LARP1 3'UTR GFP Stable Cell Line

TU062268 1.0 ml
EUR 2333

LARP1 3'UTR Luciferase Stable Cell Line

TU012268 1.0 ml
EUR 2333

Mouse La- related protein 1, Larp1 ELISA KIT

ELI-43204m 96 Tests
EUR 865

Human La- related protein 1, LARP1 ELISA KIT

ELI-46492h 96 Tests
EUR 824

Human La-Related Protein 1 (LARP1) ELISA Kit

abx388226-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

LARP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711861 1.0 ug DNA
EUR 316

LARP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711865 1.0 ug DNA
EUR 316

LARP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711866 1.0 ug DNA
EUR 316

LARP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711867 1.0 ug DNA
EUR 316

LARP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711871 1.0 ug DNA
EUR 316

LARP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711872 1.0 ug DNA
EUR 316

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

LARP1 Rabbit Polyclonal Antibody