IPO5 Rabbit Polyclonal Antibody

IPO5 Rabbit Polyclonal Antibody

 

IPO5 Polyclonal Antibody

ABP58959-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IPO5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IPO5 from Human, Mouse. This IPO5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IPO5 protein

IPO5 Rabbit pAb

A1984-100ul 100 ul
EUR 308

IPO5 Rabbit pAb

A1984-200ul 200 ul
EUR 459

IPO5 Rabbit pAb

A1984-20ul 20 ul
EUR 183

IPO5 Rabbit pAb

A1984-50ul 50 ul
EUR 223

IPO5 Antibody

ABD6735 100 ug
EUR 438

IPO5 Antibody

43014-100ul 100ul
EUR 252

IPO5 Antibody

32535-100ul 100ul
EUR 252

IPO5 Antibody

DF6735 200ul
EUR 304
Description: IPO5 Antibody detects endogenous levels of total IPO5.

IPO5 Conjugated Antibody

C43014 100ul
EUR 397

IPO5 Conjugated Antibody

C32535 100ul
EUR 397

Anti-IPO5 antibody

STJ24218 100 µl
EUR 277
Description: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family.

Anti-IPO5 antibody

STJ190907 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IPO5

IPO5 siRNA

20-abx920726
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IPO5 siRNA

20-abx920727
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-IPO5

PVT18182 2 ug
EUR 300

Importin-5 (IPO5) Antibody

20-abx001616
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

IPO5 cloning plasmid

CSB-CL011778HU-10ug 10ug
EUR 1174
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3294
  • Sequence: atggcggcggccgcggcggagcagcaacagttctacctgctcctgggaaacctgctcagccccgacaatgtggtccggaaacaggcagaggaaacctatgagaatatcccaggccagtcaaagatcacattcctcttacaagccatcagaaatacaacagctgctgaagaggcta
  • Show more
Description: A cloning plasmid for the IPO5 gene.

IPO5 Blocking Peptide

DF6735-BP 1mg
EUR 195

Mouse IPO5 shRNA Plasmid

20-abx977251
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IPO5 shRNA Plasmid

20-abx952606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IPO5 ORF Vector (Human) (pORF)

ORF005422 1.0 ug DNA
EUR 95

Ipo5 ORF Vector (Mouse) (pORF)

ORF048018 1.0 ug DNA
EUR 506

Monoclonal IPO5 / RANBP5 Antibody (clone 1C4), Clone: 1C4

APR16883G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human IPO5 / RANBP5 (clone 1C4). The antibodies are raised in Mouse and are from clone 1C4. This antibody is applicable in WB and IHC-P, E

Mouse Importin- 5, Ipo5 ELISA KIT

ELI-13013m 96 Tests
EUR 865

Human Importin- 5, IPO5 ELISA KIT

ELI-37719h 96 Tests
EUR 824

IPO5 sgRNA CRISPR Lentivector set (Human)

K1094201 3 x 1.0 ug
EUR 339

Ipo5 sgRNA CRISPR Lentivector set (Mouse)

K4835001 3 x 1.0 ug
EUR 339

Human Importin 5(IPO5)ELISA Kit

QY-E01483 96T
EUR 374

IPO5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1094202 1.0 ug DNA
EUR 154

IPO5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1094203 1.0 ug DNA
EUR 154

IPO5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1094204 1.0 ug DNA
EUR 154

Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4835002 1.0 ug DNA
EUR 154

Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4835003 1.0 ug DNA
EUR 154

Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4835004 1.0 ug DNA
EUR 154

IPO5 Protein Vector (Human) (pPB-C-His)

PV021685 500 ng
EUR 329

IPO5 Protein Vector (Human) (pPB-N-His)

PV021686 500 ng
EUR 329

IPO5 Protein Vector (Human) (pPM-C-HA)

PV021687 500 ng
EUR 329

IPO5 Protein Vector (Human) (pPM-C-His)

PV021688 500 ng
EUR 329

IPO5 Protein Vector (Mouse) (pPB-C-His)

PV192070 500 ng
EUR 1065

IPO5 Protein Vector (Mouse) (pPB-N-His)

PV192071 500 ng
EUR 1065

IPO5 Protein Vector (Mouse) (pPM-C-HA)

PV192072 500 ng
EUR 1065

IPO5 Protein Vector (Mouse) (pPM-C-His)

PV192073 500 ng
EUR 1065

Ipo5 3'UTR Luciferase Stable Cell Line

TU206345 1.0 ml Ask for price

Ipo5 3'UTR GFP Stable Cell Line

TU160175 1.0 ml Ask for price

IPO5 3'UTR Luciferase Stable Cell Line

TU011218 1.0 ml
EUR 1521

Ipo5 3'UTR Luciferase Stable Cell Line

TU110175 1.0 ml Ask for price

IPO5 3'UTR GFP Stable Cell Line

TU061218 1.0 ml
EUR 1521

Ipo5 3'UTR GFP Stable Cell Line

TU256345 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IPO5 Rabbit Polyclonal Antibody