IPO5 Rabbit Polyclonal Antibody

IPO5 Rabbit Polyclonal Antibody

 

IPO5 Polyclonal Antibody

ES9749-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IPO5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IPO5 Rabbit pAb

A1984-100ul 100 ul
EUR 308

IPO5 Rabbit pAb

A1984-200ul 200 ul
EUR 459

IPO5 Rabbit pAb

A1984-20ul 20 ul
EUR 183

IPO5 Rabbit pAb

A1984-50ul 50 ul
EUR 223

IPO5 Antibody

32535-100ul 100ul
EUR 252

IPO5 Antibody

43014-100ul 100ul
EUR 252

IPO5 Antibody

DF6735 200ul
EUR 304
Description: IPO5 Antibody detects endogenous levels of total IPO5.

IPO5 Antibody

ABD6735 100 ug
EUR 438

IPO5 Conjugated Antibody

C43014 100ul
EUR 397

IPO5 Conjugated Antibody

C32535 100ul
EUR 397

Anti-IPO5 antibody

STJ24218 100 µl
EUR 277
Description: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family.

Anti-IPO5 antibody

STJ190907 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IPO5

IPO5 siRNA

20-abx920726
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IPO5 siRNA

20-abx920727
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-IPO5

PVT18182 2 ug
EUR 300

Importin-5 (IPO5) Antibody

20-abx001616
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

IPO5 Blocking Peptide

DF6735-BP 1mg
EUR 195

IPO5 cloning plasmid

CSB-CL011778HU-10ug 10ug
EUR 1174
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3294
  • Sequence: atggcggcggccgcggcggagcagcaacagttctacctgctcctgggaaacctgctcagccccgacaatgtggtccggaaacaggcagaggaaacctatgagaatatcccaggccagtcaaagatcacattcctcttacaagccatcagaaatacaacagctgctgaagaggcta
  • Show more
Description: A cloning plasmid for the IPO5 gene.

Mouse IPO5 shRNA Plasmid

20-abx977251
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IPO5 shRNA Plasmid

20-abx952606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IPO5 ORF Vector (Human) (pORF)

ORF005422 1.0 ug DNA
EUR 95

Ipo5 ORF Vector (Mouse) (pORF)

ORF048018 1.0 ug DNA
EUR 506

Monoclonal IPO5 / RANBP5 Antibody (clone 1C4), Clone: 1C4

APR16883G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human IPO5 / RANBP5 (clone 1C4). The antibodies are raised in Mouse and are from clone 1C4. This antibody is applicable in WB and IHC-P, E

Mouse Importin- 5, Ipo5 ELISA KIT

ELI-13013m 96 Tests
EUR 865

Human Importin- 5, IPO5 ELISA KIT

ELI-37719h 96 Tests
EUR 824

Ipo5 sgRNA CRISPR Lentivector set (Mouse)

K4835001 3 x 1.0 ug
EUR 339

IPO5 sgRNA CRISPR Lentivector set (Human)

K1094201 3 x 1.0 ug
EUR 339

Human Importin 5(IPO5)ELISA Kit

QY-E01483 96T
EUR 374

Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4835002 1.0 ug DNA
EUR 154

Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4835003 1.0 ug DNA
EUR 154

Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4835004 1.0 ug DNA
EUR 154

IPO5 sgRNA CRISPR Lentivector (Human) (Target 1)

K1094202 1.0 ug DNA
EUR 154

IPO5 sgRNA CRISPR Lentivector (Human) (Target 2)

K1094203 1.0 ug DNA
EUR 154

IPO5 sgRNA CRISPR Lentivector (Human) (Target 3)

K1094204 1.0 ug DNA
EUR 154

IPO5 Protein Vector (Human) (pPB-C-His)

PV021685 500 ng
EUR 329

IPO5 Protein Vector (Human) (pPB-N-His)

PV021686 500 ng
EUR 329

IPO5 Protein Vector (Human) (pPM-C-HA)

PV021687 500 ng
EUR 329

IPO5 Protein Vector (Human) (pPM-C-His)

PV021688 500 ng
EUR 329

IPO5 Protein Vector (Mouse) (pPB-C-His)

PV192070 500 ng
EUR 1065

IPO5 Protein Vector (Mouse) (pPB-N-His)

PV192071 500 ng
EUR 1065

IPO5 Protein Vector (Mouse) (pPM-C-HA)

PV192072 500 ng
EUR 1065

IPO5 Protein Vector (Mouse) (pPM-C-His)

PV192073 500 ng
EUR 1065

Ipo5 3'UTR Luciferase Stable Cell Line

TU110175 1.0 ml Ask for price

Ipo5 3'UTR GFP Stable Cell Line

TU160175 1.0 ml Ask for price

Ipo5 3'UTR Luciferase Stable Cell Line

TU206345 1.0 ml Ask for price

Ipo5 3'UTR GFP Stable Cell Line

TU256345 1.0 ml Ask for price

IPO5 3'UTR GFP Stable Cell Line

TU061218 1.0 ml
EUR 1521

IPO5 3'UTR Luciferase Stable Cell Line

TU011218 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

IPO5 Rabbit Polyclonal Antibody