IPO5 Rabbit Polyclonal Antibody
IPO5 Polyclonal Antibody |
ABP58959-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IPO5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IPO5 from Human, Mouse. This IPO5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IPO5 protein |
IPO5 Rabbit pAb |
A1984-100ul |
Abclonal |
100 ul |
EUR 308 |
IPO5 Rabbit pAb |
A1984-200ul |
Abclonal |
200 ul |
EUR 459 |
IPO5 Rabbit pAb |
A1984-20ul |
Abclonal |
20 ul |
EUR 183 |
IPO5 Rabbit pAb |
A1984-50ul |
Abclonal |
50 ul |
EUR 223 |
IPO5 Antibody |
43014-100ul |
SAB |
100ul |
EUR 252 |
IPO5 Antibody |
32535-100ul |
SAB |
100ul |
EUR 252 |
IPO5 Antibody |
DF6735 |
Affbiotech |
200ul |
EUR 304 |
Description: IPO5 Antibody detects endogenous levels of total IPO5. |
IPO5 Conjugated Antibody |
C43014 |
SAB |
100ul |
EUR 397 |
IPO5 Conjugated Antibody |
C32535 |
SAB |
100ul |
EUR 397 |
Anti-IPO5 antibody |
STJ24218 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. |
Anti-IPO5 antibody |
STJ190907 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IPO5 |
IPO5 siRNA |
20-abx920726 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IPO5 siRNA |
20-abx920727 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Importin-5 (IPO5) Antibody |
20-abx001616 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
IPO5 cloning plasmid |
CSB-CL011778HU-10ug |
Cusabio |
10ug |
EUR 1174 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3294
- Sequence: atggcggcggccgcggcggagcagcaacagttctacctgctcctgggaaacctgctcagccccgacaatgtggtccggaaacaggcagaggaaacctatgagaatatcccaggccagtcaaagatcacattcctcttacaagccatcagaaatacaacagctgctgaagaggcta
- Show more
|
Description: A cloning plasmid for the IPO5 gene. |
IPO5 Blocking Peptide |
DF6735-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse IPO5 shRNA Plasmid |
20-abx977251 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human IPO5 shRNA Plasmid |
20-abx952606 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
IPO5 ORF Vector (Human) (pORF) |
ORF005422 |
ABM |
1.0 ug DNA |
EUR 95 |
Ipo5 ORF Vector (Mouse) (pORF) |
ORF048018 |
ABM |
1.0 ug DNA |
EUR 506 |
Monoclonal IPO5 / RANBP5 Antibody (clone 1C4), Clone: 1C4 |
APR16883G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human IPO5 / RANBP5 (clone 1C4). The antibodies are raised in Mouse and are from clone 1C4. This antibody is applicable in WB and IHC-P, E |
IPO5 sgRNA CRISPR Lentivector set (Human) |
K1094201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ipo5 sgRNA CRISPR Lentivector set (Mouse) |
K4835001 |
ABM |
3 x 1.0 ug |
EUR 339 |
IPO5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1094202 |
ABM |
1.0 ug DNA |
EUR 154 |
IPO5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1094203 |
ABM |
1.0 ug DNA |
EUR 154 |
IPO5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1094204 |
ABM |
1.0 ug DNA |
EUR 154 |
Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4835002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4835003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ipo5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4835004 |
ABM |
1.0 ug DNA |
EUR 154 |
IPO5 Protein Vector (Human) (pPB-C-His) |
PV021685 |
ABM |
500 ng |
EUR 329 |
IPO5 Protein Vector (Human) (pPB-N-His) |
PV021686 |
ABM |
500 ng |
EUR 329 |
IPO5 Protein Vector (Human) (pPM-C-HA) |
PV021687 |
ABM |
500 ng |
EUR 329 |
IPO5 Protein Vector (Human) (pPM-C-His) |
PV021688 |
ABM |
500 ng |
EUR 329 |
IPO5 Protein Vector (Mouse) (pPB-C-His) |
PV192070 |
ABM |
500 ng |
EUR 1065 |
IPO5 Protein Vector (Mouse) (pPB-N-His) |
PV192071 |
ABM |
500 ng |
EUR 1065 |
IPO5 Protein Vector (Mouse) (pPM-C-HA) |
PV192072 |
ABM |
500 ng |
EUR 1065 |
IPO5 Protein Vector (Mouse) (pPM-C-His) |
PV192073 |
ABM |
500 ng |
EUR 1065 |
Ipo5 3'UTR Luciferase Stable Cell Line |
TU206345 |
ABM |
1.0 ml |
Ask for price |
Ipo5 3'UTR GFP Stable Cell Line |
TU160175 |
ABM |
1.0 ml |
Ask for price |
IPO5 3'UTR Luciferase Stable Cell Line |
TU011218 |
ABM |
1.0 ml |
EUR 1521 |
Ipo5 3'UTR Luciferase Stable Cell Line |
TU110175 |
ABM |
1.0 ml |
Ask for price |
IPO5 3'UTR GFP Stable Cell Line |
TU061218 |
ABM |
1.0 ml |
EUR 1521 |
Ipo5 3'UTR GFP Stable Cell Line |
TU256345 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IPO5 Rabbit Polyclonal Antibody