INVS Rabbit Polyclonal Antibody

INVS Rabbit Polyclonal Antibody


INVS Polyclonal Antibody

27359-100ul 100ul
EUR 252

INVS Polyclonal Antibody

27359-50ul 50ul
EUR 187

INVS Rabbit pAb

A10298-100ul 100 ul
EUR 308

INVS Rabbit pAb

A10298-200ul 200 ul
EUR 459

INVS Rabbit pAb

A10298-20ul 20 ul
EUR 183

INVS Rabbit pAb

A10298-50ul 50 ul
EUR 223

INVS Polyclonal Conjugated Antibody

C27359 100ul
EUR 397

INVS antibody

70R-17995 50 ul
EUR 435
Description: Rabbit polyclonal INVS antibody

INVS Antibody

DF12644 200ul
EUR 304
Description: INVS Antibody detects endogenous levels of INVS.

INVS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

INVS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

anti- INVS antibody

FNab04369 100µg
EUR 505.25
  • Immunogen: inversin
  • Uniprot ID: Q9Y283
  • Gene ID: 27130
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against INVS

Inversin (INVS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody

abx145614-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody

abx234369-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-INVS antibody

PAab04369 100 ug
EUR 355

Anti-INVS antibody

STJ112336 100 µl
EUR 277
Description: This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-INVS antibody

STJ190912 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to INVS


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

INVS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

INVS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

INVS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

INVS cloning plasmid

CSB-CL011769HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atgaacaagtcagagaacctgctgtttgctggttcatcattagcatcacaagtccatgctgctgccgttaatggagataagggtgctctacagaggctcatcgtaggaaactctgctcttaaagacaaagaagatcagtttgggagaacaccacttatgtattgcgtgttggctga
  • Show more
Description: A cloning plasmid for the INVS gene.

INVS cloning plasmid

CSB-CL011769HU2-10ug 10ug
EUR 1143
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3198
  • Show more
Description: A cloning plasmid for the INVS gene.

INVS Blocking Peptide

DF12644-BP 1mg
EUR 195


EF010366 96 Tests
EUR 689


ELI-43745d 96 Tests
EUR 928

Human INVS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken Inversin, INVS ELISA KIT

ELI-20458c 96 Tests
EUR 928

Mouse Inversin, Invs ELISA KIT

ELI-20459m 96 Tests
EUR 865

Human Inversin, INVS ELISA KIT

ELI-31073h 96 Tests
EUR 824

Human Inversin (INVS) ELISA Kit

abx388011-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Inversin (INVS) ELISA Kit

abx389650-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

INVS ORF Vector (Human) (pORF)

ORF005412 1.0 ug DNA
EUR 95

Invs ORF Vector (Rat) (pORF)

ORF068713 1.0 ug DNA
EUR 506

Invs ORF Vector (Mouse) (pORF)

ORF048006 1.0 ug DNA
EUR 506

INVS ORF Vector (Human) (pORF)

ORF013376 1.0 ug DNA
EUR 354

Human Inversin(INVS)ELISA Kit

QY-E04856 96T
EUR 361

Invs sgRNA CRISPR Lentivector set (Rat)

K6472801 3 x 1.0 ug
EUR 339

INVS sgRNA CRISPR Lentivector set (Human)

K1093501 3 x 1.0 ug
EUR 339

Invs sgRNA CRISPR Lentivector set (Mouse)

K3918701 3 x 1.0 ug
EUR 339

Invs ELISA Kit| Mouse Inversin ELISA Kit

EF015284 96 Tests
EUR 689

INVS ELISA Kit| chicken Inversin ELISA Kit

EF012355 96 Tests
EUR 689

Invs sgRNA CRISPR Lentivector (Rat) (Target 1)

K6472802 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Rat) (Target 2)

K6472803 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Rat) (Target 3)

K6472804 1.0 ug DNA
EUR 154

INVS sgRNA CRISPR Lentivector (Human) (Target 1)

K1093502 1.0 ug DNA
EUR 154

INVS sgRNA CRISPR Lentivector (Human) (Target 2)

K1093503 1.0 ug DNA
EUR 154

INVS sgRNA CRISPR Lentivector (Human) (Target 3)

K1093504 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3918702 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3918703 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3918704 1.0 ug DNA
EUR 154

INVS Protein Vector (Human) (pPB-C-His)

PV053501 500 ng
EUR 481

INVS Protein Vector (Human) (pPB-N-His)

PV053502 500 ng
EUR 481

INVS Protein Vector (Human) (pPM-C-HA)

PV053503 500 ng
EUR 481

INVS Protein Vector (Human) (pPM-C-His)

PV053504 500 ng
EUR 481

INVS Protein Vector (Human) (pPB-C-His)

PV021645 500 ng
EUR 329

INVS Protein Vector (Human) (pPB-N-His)

PV021646 500 ng
EUR 329

INVS Protein Vector (Human) (pPM-C-HA)

PV021647 500 ng
EUR 329

INVS Protein Vector (Human) (pPM-C-His)

PV021648 500 ng
EUR 329

INVS Protein Vector (Rat) (pPB-C-His)

PV274850 500 ng
EUR 1191

INVS Protein Vector (Rat) (pPB-N-His)

PV274851 500 ng
EUR 1191

INVS Protein Vector (Rat) (pPM-C-HA)

PV274852 500 ng
EUR 1191

INVS Protein Vector (Rat) (pPM-C-His)

PV274853 500 ng
EUR 1191

INVS Protein Vector (Mouse) (pPB-C-His)

PV192022 500 ng
EUR 1065

INVS Protein Vector (Mouse) (pPB-N-His)

PV192023 500 ng
EUR 1065

INVS Protein Vector (Mouse) (pPM-C-HA)

PV192024 500 ng
EUR 1065

INVS Protein Vector (Mouse) (pPM-C-His)

PV192025 500 ng
EUR 1065

Invs 3'UTR Luciferase Stable Cell Line

TU206336 1.0 ml Ask for price

Invs 3'UTR GFP Stable Cell Line

TU160166 1.0 ml Ask for price

INVS 3'UTR Luciferase Stable Cell Line

TU011211 1.0 ml
EUR 1394

Invs 3'UTR Luciferase Stable Cell Line

TU110166 1.0 ml Ask for price

INVS 3'UTR GFP Stable Cell Line

TU061211 1.0 ml
EUR 1394

Invs 3'UTR GFP Stable Cell Line

TU256336 1.0 ml Ask for price

INVS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV704289 1.0 ug DNA
EUR 450

INVS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV704293 1.0 ug DNA
EUR 450

INVS Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV704294 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

INVS Rabbit Polyclonal Antibody