INVS Rabbit Polyclonal Antibody

INVS Rabbit Polyclonal Antibody

 

INVS Polyclonal Antibody
27359-100ul 100ul
EUR 252

INVS Polyclonal Antibody
27359-50ul 50ul
EUR 187

INVS Rabbit pAb
A10298-100ul 100 ul
EUR 308

INVS Rabbit pAb
A10298-200ul 200 ul
EUR 459

INVS Rabbit pAb
A10298-20ul 20 ul
EUR 183

INVS Rabbit pAb
A10298-50ul 50 ul
EUR 223

INVS Polyclonal Conjugated Antibody
C27359 100ul
EUR 397

INVS antibody
70R-17995 50 ul
EUR 435
Description: Rabbit polyclonal INVS antibody

INVS Antibody
DF12644 200ul
EUR 304
Description: INVS Antibody detects endogenous levels of INVS.

INVS Antibody
1-CSB-PA011769GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

INVS Antibody
1-CSB-PA011769LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

anti- INVS antibody
FNab04369 100µg
EUR 505.25
  • Immunogen: inversin
  • Uniprot ID: Q9Y283
  • Gene ID: 27130
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against INVS

Inversin (INVS) Antibody
20-abx126010
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody
20-abx113270
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody
abx145614-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody
20-abx312835
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody
abx234369-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-INVS antibody
PAab04369 100 ug
EUR 355

Anti-INVS antibody
STJ112336 100 µl
EUR 277
Description: This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-INVS antibody
STJ190912 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to INVS

INVS siRNA
20-abx920709
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody (HRP)
20-abx312836
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody (FITC)
20-abx312837
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inversin (INVS) Antibody (Biotin)
20-abx312838
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

INVS Antibody, HRP conjugated
1-CSB-PA011769LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

INVS Antibody, FITC conjugated
1-CSB-PA011769LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

INVS Antibody, Biotin conjugated
1-CSB-PA011769LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against INVS. Recognizes INVS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

INVS cloning plasmid
CSB-CL011769HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 306
  • Sequence: atgaacaagtcagagaacctgctgtttgctggttcatcattagcatcacaagtccatgctgctgccgttaatggagataagggtgctctacagaggctcatcgtaggaaactctgctcttaaagacaaagaagatcagtttgggagaacaccacttatgtattgcgtgttggctga
  • Show more
Description: A cloning plasmid for the INVS gene.

INVS cloning plasmid
CSB-CL011769HU2-10ug 10ug
EUR 1143
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3198
  • Sequence: ATGAACAAGTCAGAGAACCTGCTGTTTGCTGGTTCATCATTAGCATCACAAGTCCATGCTGCTGCCGTTAATGGAGATAAGGGTGCTCTACAGAGGCTCATCGTAGGAAACTCTGCTCTTAAAGACAAAGAAGATCAGTTTGGGAGAACACCACTTATGTATTGCGTGTTGGCTG
  • Show more
Description: A cloning plasmid for the INVS gene.

INVS Blocking Peptide
DF12644-BP 1mg
EUR 195

INVS ELISA KIT|Human
EF010366 96 Tests
EUR 689

Canine INVS ELISA KIT
ELI-43745d 96 Tests
EUR 928

Human INVS shRNA Plasmid
20-abx958983
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken Inversin, INVS ELISA KIT
ELI-20458c 96 Tests
EUR 928

Mouse Inversin, Invs ELISA KIT
ELI-20459m 96 Tests
EUR 865

Human Inversin, INVS ELISA KIT
ELI-31073h 96 Tests
EUR 824

Human Inversin (INVS) ELISA Kit
abx388011-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Inversin (INVS) ELISA Kit
abx389650-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

INVS ORF Vector (Human) (pORF)
ORF005412 1.0 ug DNA
EUR 95

Invs ORF Vector (Rat) (pORF)
ORF068713 1.0 ug DNA
EUR 506

Invs ORF Vector (Mouse) (pORF)
ORF048006 1.0 ug DNA
EUR 506

INVS ORF Vector (Human) (pORF)
ORF013376 1.0 ug DNA
EUR 354

Human Inversin(INVS)ELISA Kit
QY-E04856 96T
EUR 361

Invs sgRNA CRISPR Lentivector set (Rat)
K6472801 3 x 1.0 ug
EUR 339

INVS sgRNA CRISPR Lentivector set (Human)
K1093501 3 x 1.0 ug
EUR 339

Invs sgRNA CRISPR Lentivector set (Mouse)
K3918701 3 x 1.0 ug
EUR 339

Invs ELISA Kit| Mouse Inversin ELISA Kit
EF015284 96 Tests
EUR 689

INVS ELISA Kit| chicken Inversin ELISA Kit
EF012355 96 Tests
EUR 689

Invs sgRNA CRISPR Lentivector (Rat) (Target 1)
K6472802 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Rat) (Target 2)
K6472803 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Rat) (Target 3)
K6472804 1.0 ug DNA
EUR 154

INVS sgRNA CRISPR Lentivector (Human) (Target 1)
K1093502 1.0 ug DNA
EUR 154

INVS sgRNA CRISPR Lentivector (Human) (Target 2)
K1093503 1.0 ug DNA
EUR 154

INVS sgRNA CRISPR Lentivector (Human) (Target 3)
K1093504 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3918702 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3918703 1.0 ug DNA
EUR 154

Invs sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3918704 1.0 ug DNA
EUR 154

INVS Protein Vector (Human) (pPB-C-His)
PV053501 500 ng
EUR 481

INVS Protein Vector (Human) (pPB-N-His)
PV053502 500 ng
EUR 481

INVS Protein Vector (Human) (pPM-C-HA)
PV053503 500 ng
EUR 481

INVS Protein Vector (Human) (pPM-C-His)
PV053504 500 ng
EUR 481

INVS Protein Vector (Human) (pPB-C-His)
PV021645 500 ng
EUR 329

INVS Protein Vector (Human) (pPB-N-His)
PV021646 500 ng
EUR 329

INVS Protein Vector (Human) (pPM-C-HA)
PV021647 500 ng
EUR 329

INVS Protein Vector (Human) (pPM-C-His)
PV021648 500 ng
EUR 329

INVS Protein Vector (Rat) (pPB-C-His)
PV274850 500 ng
EUR 1191

INVS Protein Vector (Rat) (pPB-N-His)
PV274851 500 ng
EUR 1191

INVS Protein Vector (Rat) (pPM-C-HA)
PV274852 500 ng
EUR 1191

INVS Protein Vector (Rat) (pPM-C-His)
PV274853 500 ng
EUR 1191

INVS Protein Vector (Mouse) (pPB-C-His)
PV192022 500 ng
EUR 1065

INVS Protein Vector (Mouse) (pPB-N-His)
PV192023 500 ng
EUR 1065

INVS Protein Vector (Mouse) (pPM-C-HA)
PV192024 500 ng
EUR 1065

INVS Protein Vector (Mouse) (pPM-C-His)
PV192025 500 ng
EUR 1065

Invs 3'UTR Luciferase Stable Cell Line
TU206336 1.0 ml Ask for price

Invs 3'UTR GFP Stable Cell Line
TU160166 1.0 ml Ask for price

INVS 3'UTR Luciferase Stable Cell Line
TU011211 1.0 ml
EUR 1394

Invs 3'UTR Luciferase Stable Cell Line
TU110166 1.0 ml Ask for price

INVS 3'UTR GFP Stable Cell Line
TU061211 1.0 ml
EUR 1394

Invs 3'UTR GFP Stable Cell Line
TU256336 1.0 ml Ask for price

INVS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704289 1.0 ug DNA
EUR 450

INVS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704293 1.0 ug DNA
EUR 450

INVS Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV704294 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

INVS Rabbit Polyclonal Antibody