HMX2 Rabbit Polyclonal Antibody

HMX2 Rabbit Polyclonal Antibody

 

Homeobox Protein HMX2 (HMX2) Antibody

abx033282-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Homeobox Protein HMX2 (HMX2) Antibody

abx033282-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

HMX2 antibody

70R-8916 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HMX2 antibody

HMX2 Antibody

1-CSB-PA010587LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMX2. Recognizes HMX2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Polyclonal HMX2 antibody - middle region

APR12377G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMX2 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal HMX2 Antibody (C-term)

APR12391G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMX2 (C-term). This antibody is tested and proven to work in the following applications:

Anti-HMX2 antibody

STJ190878 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HMX2

HMX2 siRNA

20-abx919642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMX2 siRNA

20-abx919643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMX2 Antibody, HRP conjugated

1-CSB-PA010587LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMX2. Recognizes HMX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HMX2 Antibody, FITC conjugated

1-CSB-PA010587LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMX2. Recognizes HMX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HMX2 Antibody, Biotin conjugated

1-CSB-PA010587LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMX2. Recognizes HMX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Homeobox protein HMX2, HMX2 ELISA KIT

ELI-27782h 96 Tests
EUR 824

Mouse Homeobox protein HMX2, Hmx2 ELISA KIT

ELI-38820m 96 Tests
EUR 865

HMX2 cloning plasmid

CSB-CL010587HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgggcagcaaagaagatgcgggcaaggggtgtccggcggccggtggcgtctccagcttcaccatccagtccatcctgggcgggggcccctcggaggcaccgcgggagcccgtcggctggccagccaggaagcgcagcctgtccgtgtcctcggaggaggaggagccggacgacgg
  • Show more
Description: A cloning plasmid for the HMX2 gene.

HMX2 Blocking Peptide

33R-8694 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMX2 antibody, catalog no. 70R-8916

Anti-HMX2 (1C8)

YF-MA13491 100 ug
EUR 363
Description: Mouse monoclonal to HMX2

Anti-HMX2 (1B10)

YF-MA13492 200 ul
EUR 363
Description: Mouse monoclonal to HMX2

Anti-HMX2 (1D7)

YF-MA13493 100 ug
EUR 363
Description: Mouse monoclonal to HMX2

Anti-HMX2 (2D2)

YF-MA13494 100 ug
EUR 363
Description: Mouse monoclonal to HMX2

Anti-HMX2 (1B10)

YF-MA10432 50 ug
EUR 363
Description: Mouse monoclonal to HMX2

Mouse HMX2 shRNA Plasmid

20-abx970832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HMX2 shRNA Plasmid

20-abx952162
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMX2 Recombinant Protein (Human)

RP039853 100 ug Ask for price

HMX2 Recombinant Protein (Rat)

RP204785 100 ug Ask for price

HMX2 Recombinant Protein (Mouse)

RP141938 100 ug Ask for price

Monoclonal HMX2 Antibody (clone 1B10), Clone: 1B10

APR12392G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human HMX2 (clone 1B10). The antibodies are raised in Mouse and are from clone 1B10. This antibody is applicable in WB and IHC-P, E

Monoclonal HMX2 Antibody (clone 1D7), Clone: 1D7

APR12393G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human HMX2 (clone 1D7). The antibodies are raised in Mouse and are from clone 1D7. This antibody is applicable in WB and IHC-P, E

Hmx2 ORF Vector (Rat) (pORF)

ORF068263 1.0 ug DNA
EUR 506

Hmx2 ORF Vector (Mouse) (pORF)

ORF047314 1.0 ug DNA
EUR 506

HMX2 ORF Vector (Human) (pORF)

ORF013285 1.0 ug DNA
EUR 354

Recombinant human Homeobox protein HMX2

P2263 100ug Ask for price
  • Uniprot ID: A2RU54
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Homeobox protein HMX2

Hmx2 sgRNA CRISPR Lentivector set (Rat)

K6109601 3 x 1.0 ug
EUR 339

HMX2 sgRNA CRISPR Lentivector set (Human)

K0974901 3 x 1.0 ug
EUR 339

Hmx2 sgRNA CRISPR Lentivector set (Mouse)

K3947601 3 x 1.0 ug
EUR 339

Hmx2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6109602 1.0 ug DNA
EUR 154

Hmx2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6109603 1.0 ug DNA
EUR 154

Hmx2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6109604 1.0 ug DNA
EUR 154

HMX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0974902 1.0 ug DNA
EUR 154

HMX2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0974903 1.0 ug DNA
EUR 154

HMX2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0974904 1.0 ug DNA
EUR 154

Hmx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3947602 1.0 ug DNA
EUR 154

Hmx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3947603 1.0 ug DNA
EUR 154

Hmx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3947604 1.0 ug DNA
EUR 154

HMX2 Protein Vector (Human) (pPB-C-His)

PV053137 500 ng
EUR 481

HMX2 Protein Vector (Human) (pPB-N-His)

PV053138 500 ng
EUR 481

HMX2 Protein Vector (Human) (pPM-C-HA)

PV053139 500 ng
EUR 481

HMX2 Protein Vector (Human) (pPM-C-His)

PV053140 500 ng
EUR 481

HMX2 Protein Vector (Rat) (pPB-C-His)

PV273050 500 ng
EUR 603

HMX2 Protein Vector (Rat) (pPB-N-His)

PV273051 500 ng
EUR 603

HMX2 Protein Vector (Rat) (pPM-C-HA)

PV273052 500 ng
EUR 603

HMX2 Protein Vector (Rat) (pPM-C-His)

PV273053 500 ng
EUR 603

HMX2 Protein Vector (Mouse) (pPB-C-His)

PV189254 500 ng
EUR 603

HMX2 Protein Vector (Mouse) (pPB-N-His)

PV189255 500 ng
EUR 603

HMX2 Protein Vector (Mouse) (pPM-C-HA)

PV189256 500 ng
EUR 603

HMX2 Rabbit Polyclonal Antibody