ACSL1 Rabbit Polyclonal Antibody

ACSL1 Rabbit Polyclonal Antibody


ACSL1 Polyclonal Antibody

ES9773-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACSL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACSL1 Polyclonal Antibody

ES9773-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACSL1 Rabbit pAb

A1000-100ul 100 ul
EUR 384

ACSL1 Rabbit pAb

A1000-200ul 200 ul Ask for price

ACSL1 Rabbit pAb

A1000-20ul 20 ul Ask for price

ACSL1 Rabbit pAb

A1000-50ul 50 ul
EUR 265

ACSL1 Rabbit pAb

A16253-100ul 100 ul
EUR 308

ACSL1 Rabbit pAb

A16253-200ul 200 ul
EUR 459

ACSL1 Rabbit pAb

A16253-20ul 20 ul
EUR 183

ACSL1 Rabbit pAb

A16253-50ul 50 ul
EUR 223

ACSL1 antibody

70R-15554 50 ul
EUR 435
Description: Rabbit polyclonal ACSL1 antibody

ACSL1 Antibody

46031-100ul 100ul
EUR 252

ACSL1 Antibody

46031-50ul 50ul
EUR 187

ACSL1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ACSL1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ACSL1 Antibody

DF9605 200ul
EUR 304
Description: ACSL1 Antibody detects endogenous levels of total ACSL1.

ACSL1 antibody

70R-6937 50 ug
EUR 467
Description: Rabbit polyclonal ACSL1 antibody raised against the C terminal of ACSL1

ACSL1 antibody

70R-6456 50 ug
EUR 467
Description: Rabbit polyclonal ACSL1 antibody raised against the N terminal of ACSL1

ACSL1 Antibody

ABD9605 100 ug
EUR 438

Polyclonal FACL2 / ACSL1 Antibody (Internal)

AMM04497G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FACL2 / ACSL1 (Internal). This antibody is tested and proven to work in the following applications:

Acsl1/ Rat Acsl1 ELISA Kit

ELI-49509r 96 Tests
EUR 886

ACSL1 Conjugated Antibody

C46031 100ul
EUR 397

anti- ACSL1 antibody

FNab00106 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IF: 1:20-1:200
  • IHC: 1:20-1:200
  • Immunogen: acyl-CoA synthetase long-chain family member 1
  • Uniprot ID: P33121
  • Gene ID: 2180
  • Research Area: Metabolism
Description: Antibody raised against ACSL1

Anti-ACSL1 antibody

PAab00106 100 ug
EUR 355

Anti-ACSL1 Antibody

PB10025 100ug/vial
EUR 334

Anti-ACSL1 antibody

STJ118001 100 µl
EUR 393

Anti-ACSL1 antibody

STJ118705 100 µl
EUR 277

Anti-ACSL1 antibody

STJ190931 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ACSL1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACSL1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACSL1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACSL1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ACSL1 Blocking Peptide

33R-3560 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACSL1 antibody, catalog no. 70R-6937

ACSL1 Blocking Peptide

33R-1349 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FST antibody, catalog no. 70R-5432

ACSL1 Blocking Peptide

DF9605-BP 1mg
EUR 195

ACSL1 cloning plasmid

CSB-CL001191HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2097
  • Sequence: atgcaagcccatgagctgttccggtattttcgaatgccagaactggttgacttccgacagtacgtgcgtactcttccgaccaacacgcttatgggcttcggagcttttgcagcactcaccaccttctggtacgccacgagacccaaacccctgaagccgccatgcgacctctcca
  • Show more
Description: A cloning plasmid for the ACSL1 gene.

Anti-ACSL1 (3G4)

YF-MA12950 100 ug
EUR 363
Description: Mouse monoclonal to ACSL1


EF007583 96 Tests
EUR 689

Rat ACSL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ACSL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ACSL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ACSL1 Recombinant Protein (Human)

RP000319 100 ug Ask for price

ACSL1 Recombinant Protein (Mouse)

RP113948 100 ug Ask for price

ACSL1 Recombinant Protein (Rat)

RP188963 100 ug Ask for price

Monoclonal ACSL1 Antibody (monoclonal) (M02), Clone: 3G4

APG01519G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ACSL1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G4. This antibody is applicable in WB, E

Acsl1 ORF Vector (Rat) (pORF)

ORF062989 1.0 ug DNA
EUR 506

ACSL1 ORF Vector (Human) (pORF)

ORF000107 1.0 ug DNA
EUR 95

Acsl1 ORF Vector (Mouse) (pORF)

ORF037984 1.0 ug DNA
EUR 506

ACSL1 ELISA Kit (Human) (OKCA01339)

OKCA01339 96 Wells
EUR 846
Description: Description of target: Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation. Preferentially uses palmitoleate, oleate and linoleate. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL

ACSL1 ELISA Kit (Mouse) (OKCA01711)

OKCA01711 96 Wells
EUR 846
Description: Description of target: Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation. Preferentially uses oleate, arachidonate, eicosapentaenoate and docosahexaenoate as substrates.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL

Acsl1 sgRNA CRISPR Lentivector set (Rat)

K6899601 3 x 1.0 ug
EUR 339

ACSL1 sgRNA CRISPR Lentivector set (Human)

K0032701 3 x 1.0 ug
EUR 339

Acsl1 sgRNA CRISPR Lentivector set (Mouse)

K3712901 3 x 1.0 ug
EUR 339

Acsl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6899602 1.0 ug DNA
EUR 154

Acsl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6899603 1.0 ug DNA
EUR 154

Acsl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6899604 1.0 ug DNA
EUR 154

ACSL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0032702 1.0 ug DNA
EUR 154

ACSL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0032703 1.0 ug DNA
EUR 154

ACSL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0032704 1.0 ug DNA
EUR 154

Acsl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3712902 1.0 ug DNA
EUR 154

Acsl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3712903 1.0 ug DNA
EUR 154

Acsl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3712904 1.0 ug DNA
EUR 154

ACSL1 Protein Vector (Mouse) (pPB-C-His)

PV151934 500 ng
EUR 1065

ACSL1 Protein Vector (Mouse) (pPB-N-His)

PV151935 500 ng
EUR 1065

ACSL1 Protein Vector (Mouse) (pPM-C-HA)

PV151936 500 ng
EUR 1065

ACSL1 Protein Vector (Mouse) (pPM-C-His)

PV151937 500 ng
EUR 1065

ACSL1 Protein Vector (Rat) (pPB-C-His)

PV251954 500 ng
EUR 1166

ACSL1 Protein Vector (Rat) (pPB-N-His)

PV251955 500 ng
EUR 1166

ACSL1 Protein Vector (Rat) (pPM-C-HA)

PV251956 500 ng
EUR 1166

ACSL1 Protein Vector (Rat) (pPM-C-His)

PV251957 500 ng
EUR 1166

ACSL1 Protein Vector (Human) (pPB-His-MBP)

PV319338 500 ng
EUR 329

ACSL1 Protein Vector (Human) (pPB-His-GST)

PV319339 500 ng
EUR 329

ACSL1 Protein Vector (Human) (pPB-C-His)

PV000425 500 ng
EUR 329

ACSL1 Protein Vector (Human) (pPB-N-His)

PV000426 500 ng
EUR 329

ACSL1 Protein Vector (Human) (pPM-C-HA)

PV000427 500 ng
EUR 329

ACSL1 Protein Vector (Human) (pPM-C-His)

PV000428 500 ng
EUR 329

Acsl1 3'UTR Luciferase Stable Cell Line

TU101298 1.0 ml Ask for price

Acsl1 3'UTR GFP Stable Cell Line

TU151298 1.0 ml Ask for price

Acsl1 3'UTR Luciferase Stable Cell Line

TU200194 1.0 ml Ask for price

Acsl1 3'UTR GFP Stable Cell Line

TU250194 1.0 ml Ask for price

ACSL1 3'UTR GFP Stable Cell Line

TU050199 1.0 ml
EUR 1521

ACSL1 3'UTR Luciferase Stable Cell Line

TU000199 1.0 ml
EUR 1521

Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody

abx031483-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody

abx031483-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody

abx230106-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ACSL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV677305 1.0 ug DNA
EUR 1355

ACSL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV677309 1.0 ug DNA
EUR 1355

ACSL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV677310 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

ACSL1 Rabbit Polyclonal Antibody