ACSL1 Rabbit Polyclonal Antibody
 ACSL1 Polyclonal Antibody |
|
ABP57692-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ACSL1 protein at amino acid sequence of 210-290
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSL1 from Human, Mouse, Rat. This ACSL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSL1 protein at amino acid sequence of 210-290 |
ACSL1 Polyclonal Antibody |
|
ABP57692-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ACSL1 protein at amino acid sequence of 210-290
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ACSL1 from Human, Mouse, Rat. This ACSL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSL1 protein at amino acid sequence of 210-290 |
 ACSL1 Rabbit pAb |
|
A1000-100ul |
Abclonal |
100 ul |
EUR 384 |
ACSL1 Rabbit pAb |
|
A1000-200ul |
Abclonal |
200 ul |
Ask for price |
ACSL1 Rabbit pAb |
|
A1000-20ul |
Abclonal |
20 ul |
Ask for price |
ACSL1 Rabbit pAb |
|
A1000-50ul |
Abclonal |
50 ul |
EUR 265 |
ACSL1 Rabbit pAb |
|
A16253-100ul |
Abclonal |
100 ul |
EUR 308 |
ACSL1 Rabbit pAb |
|
A16253-200ul |
Abclonal |
200 ul |
EUR 459 |
ACSL1 Rabbit pAb |
|
A16253-20ul |
Abclonal |
20 ul |
EUR 183 |
ACSL1 Rabbit pAb |
|
A16253-50ul |
Abclonal |
50 ul |
EUR 223 |
 ACSL1 antibody |
|
70R-6937 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal ACSL1 antibody raised against the C terminal of ACSL1 |
ACSL1 antibody |
|
70R-6456 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal ACSL1 antibody raised against the N terminal of ACSL1 |
 ACSL1 Antibody |
|
46031-100ul |
SAB |
100ul |
EUR 252 |
ACSL1 Antibody |
|
46031-50ul |
SAB |
50ul |
EUR 187 |
ACSL1 antibody |
|
70R-15554 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal ACSL1 antibody |
ACSL1 Antibody |
|
DF9605 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ACSL1 Antibody detects endogenous levels of total ACSL1. |
ACSL1 Antibody |
|
1-CSB-PA001191GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ACSL1 Antibody |
|
1-CSB-PA001191LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
) Polyclonal FACL2 / ACSL1 Antibody (Internal) |
|
AMM04497G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FACL2 / ACSL1 (Internal). This antibody is tested and proven to work in the following applications: |
 ACSL1 Conjugated Antibody |
|
C46031 |
SAB |
100ul |
EUR 397 |
 anti- ACSL1 antibody |
|
FNab00106 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:2000
- IF: 1:20-1:200
- IHC: 1:20-1:200
- Immunogen: acyl-CoA synthetase long-chain family member 1
- Uniprot ID: P33121
- Gene ID: 2180
- Research Area: Metabolism
|
|
Description: Antibody raised against ACSL1 |
 Anti-ACSL1 Antibody |
|
PB10025 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-ACSL1 antibody |
|
STJ190931 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ACSL1 |
 ACSL1 siRNA |
|
20-abx900135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACSL1 siRNA |
|
20-abx906584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACSL1 siRNA |
|
20-abx906585 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ACSL1 Antibody, HRP conjugated |
|
1-CSB-PA001191LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 ACSL1 Antibody, FITC conjugated |
|
1-CSB-PA001191LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 ACSL1 Antibody, Biotin conjugated |
|
1-CSB-PA001191LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ACSL1. Recognizes ACSL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ACSL1 Blocking Peptide |
|
33R-3560 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACSL1 antibody, catalog no. 70R-6937 |
ACSL1 Blocking Peptide |
|
33R-1349 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FST antibody, catalog no. 70R-5432 |
ACSL1 Blocking Peptide |
|
DF9605-BP |
Affbiotech |
1mg |
EUR 195 |
 ACSL1 cloning plasmid |
|
CSB-CL001191HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2097
- Sequence: atgcaagcccatgagctgttccggtattttcgaatgccagaactggttgacttccgacagtacgtgcgtactcttccgaccaacacgcttatgggcttcggagcttttgcagcactcaccaccttctggtacgccacgagacccaaacccctgaagccgccatgcgacctctcca
- Show more
|
|
Description: A cloning plasmid for the ACSL1 gene. |
) Anti-ACSL1 (3G4) |
|
YF-MA12950 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ACSL1 |
 Rat ACSL1 shRNA Plasmid |
|
20-abx984897 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ACSL1 shRNA Plasmid |
|
20-abx951518 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse ACSL1 shRNA Plasmid |
|
20-abx970273 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ACSL1 Recombinant Protein (Human) |
|
RP000319 |
ABM |
100 ug |
Ask for price |
) ACSL1 Recombinant Protein (Rat) |
|
RP188963 |
ABM |
100 ug |
Ask for price |
) ACSL1 Recombinant Protein (Mouse) |
|
RP113948 |
ABM |
100 ug |
Ask for price |
 (M02), Clone: 3G4) Monoclonal ACSL1 Antibody (monoclonal) (M02), Clone: 3G4 |
|
APG01519G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human ACSL1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G4. This antibody is applicable in WB, E |
 (pORF)) ACSL1 ORF Vector (Human) (pORF) |
|
ORF000107 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Acsl1 ORF Vector (Mouse) (pORF) |
|
ORF037984 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Acsl1 ORF Vector (Rat) (pORF) |
|
ORF062989 |
ABM |
1.0 ug DNA |
EUR 506 |
) ACSL1 sgRNA CRISPR Lentivector set (Human) |
|
K0032701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Acsl1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3712901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Acsl1 sgRNA CRISPR Lentivector set (Rat) |
|
K6899601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) ACSL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0032702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ACSL1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0032703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ACSL1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0032704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Acsl1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3712902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Acsl1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3712903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Acsl1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3712904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ACSL1 Protein Vector (Human) (pPB-C-His) |
|
PV000425 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ACSL1 Protein Vector (Human) (pPB-N-His) |
|
PV000426 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ACSL1 Protein Vector (Human) (pPM-C-HA) |
|
PV000427 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ACSL1 Protein Vector (Human) (pPM-C-His) |
|
PV000428 |
ABM |
500 ng |
EUR 329 |
 (Target 1)) Acsl1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6899602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Acsl1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6899603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Acsl1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6899604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-His-MBP)) ACSL1 Protein Vector (Human) (pPB-His-MBP) |
|
PV319338 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) ACSL1 Protein Vector (Human) (pPB-His-GST) |
|
PV319339 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ACSL1 Protein Vector (Mouse) (pPB-C-His) |
|
PV151934 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) ACSL1 Protein Vector (Mouse) (pPB-N-His) |
|
PV151935 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) ACSL1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV151936 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) ACSL1 Protein Vector (Mouse) (pPM-C-His) |
|
PV151937 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) ACSL1 Protein Vector (Rat) (pPB-C-His) |
|
PV251954 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) ACSL1 Protein Vector (Rat) (pPB-N-His) |
|
PV251955 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) ACSL1 Protein Vector (Rat) (pPM-C-HA) |
|
PV251956 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) ACSL1 Protein Vector (Rat) (pPM-C-His) |
|
PV251957 |
ABM |
500 ng |
EUR 1166 |
 Acsl1 3'UTR Luciferase Stable Cell Line |
|
TU200194 |
ABM |
1.0 ml |
Ask for price |
 Acsl1 3'UTR GFP Stable Cell Line |
|
TU151298 |
ABM |
1.0 ml |
Ask for price |
 ACSL1 3'UTR Luciferase Stable Cell Line |
|
TU000199 |
ABM |
1.0 ml |
EUR 1521 |
Acsl1 3'UTR Luciferase Stable Cell Line |
|
TU101298 |
ABM |
1.0 ml |
Ask for price |
 ACSL1 3'UTR GFP Stable Cell Line |
|
TU050199 |
ABM |
1.0 ml |
EUR 1521 |
Acsl1 3'UTR GFP Stable Cell Line |
|
TU250194 |
ABM |
1.0 ml |
Ask for price |
 Antibody) Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody |
|
20-abx110794 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody |
|
20-abx147937 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody |
|
abx031483-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody |
|
abx031483-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody |
|
20-abx333787 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) Antibody |
|
abx230106-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) ACSL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV677305 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) ACSL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV677309 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) ACSL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV677310 |
ABM |
1.0 ug DNA |
EUR 1355 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
ACSL1 Rabbit Polyclonal Antibody
